\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816013049:

Variant ID: vg0816013049 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16013049
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTACAGCCTGGGCCTACTCCCGCACCTCAAGAGTCGCAGAAGCGGCCGGGGAACCTCGGGGTGCCACGTCGTGTCCCTCGGGCCCTCGCGCTGCCTCG[T/C]
CCCGAGGCCCTCGCCCAACTGCCATGTGGAGGGTGGAGCGAGCGGGGAGGGGACCCAGGCTGAACAGCCATCAATGCGTGGCGCCCCAACTATCCCTCAC

Reverse complement sequence

GTGAGGGATAGTTGGGGCGCCACGCATTGATGGCTGTTCAGCCTGGGTCCCCTCCCCGCTCGCTCCACCCTCCACATGGCAGTTGGGCGAGGGCCTCGGG[A/G]
CGAGGCAGCGCGAGGGCCCGAGGGACACGACGTGGCACCCCGAGGTTCCCCGGCCGCTTCTGCGACTCTTGAGGTGCGGGAGTAGGCCCAGGCTGTAGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.70% 16.30% 0.06% 0.00% NA
All Indica  2759 99.10% 0.80% 0.07% 0.00% NA
All Japonica  1512 58.30% 41.70% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.50% 1.30% 0.17% 0.00% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 27.80% 72.20% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 71.00% 29.00% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816013049 T -> C LOC_Os08g26260.1 downstream_gene_variant ; 1412.0bp to feature; MODIFIER silent_mutation Average:67.63; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg0816013049 T -> C LOC_Os08g26270.1 downstream_gene_variant ; 2182.0bp to feature; MODIFIER silent_mutation Average:67.63; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg0816013049 T -> C LOC_Os08g26280.1 downstream_gene_variant ; 4358.0bp to feature; MODIFIER silent_mutation Average:67.63; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N
vg0816013049 T -> C LOC_Os08g26260-LOC_Os08g26270 intergenic_region ; MODIFIER silent_mutation Average:67.63; most accessible tissue: Zhenshan97 young leaf, score: 85.542 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0816013049 T C 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816013049 NA 2.37E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013049 NA 4.43E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013049 NA 1.11E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013049 NA 2.04E-07 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013049 NA 1.16E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013049 NA 1.35E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013049 9.59E-06 9.59E-06 mr1488 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013049 NA 3.60E-07 mr1492 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013049 NA 6.70E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013049 3.57E-06 3.56E-06 mr1797 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013049 3.57E-06 3.56E-06 mr1801 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013049 4.30E-06 4.30E-06 mr1802 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013049 NA 2.98E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013049 NA 2.13E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013049 NA 2.25E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013049 NA 4.51E-16 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013049 NA 4.52E-11 mr1952_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013049 NA 8.50E-09 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251