| Variant ID: vg0815981055 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 15981055 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GCCTGCCGCCGACTCCTGTCGCCGCCGGTCTGACCGCCGGTGCGCCGCCGGTCTGACCGTCGAAACTCGGTGAAATACAAATCGAAGAACTCTTAAAGTA[G/T]
ATGACGACTTTATTGATTCTCTCTGTGTTTACAAAGTGGACCAACAACACTCCTTACAAAAATTTCGACTAAACTCGAAACCCTAACTCAAAACTCAACT
AGTTGAGTTTTGAGTTAGGGTTTCGAGTTTAGTCGAAATTTTTGTAAGGAGTGTTGTTGGTCCACTTTGTAAACACAGAGAGAATCAATAAAGTCGTCAT[C/A]
TACTTTAAGAGTTCTTCGATTTGTATTTCACCGAGTTTCGACGGTCAGACCGGCGGCGCACCGGCGGTCAGACCGGCGGCGACAGGAGTCGGCGGCAGGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.90% | 25.00% | 22.37% | 4.76% | NA |
| All Indica | 2759 | 57.70% | 2.00% | 32.84% | 7.47% | NA |
| All Japonica | 1512 | 22.20% | 71.60% | 5.42% | 0.86% | NA |
| Aus | 269 | 83.30% | 5.20% | 10.41% | 1.12% | NA |
| Indica I | 595 | 66.10% | 1.00% | 26.89% | 6.05% | NA |
| Indica II | 465 | 36.30% | 4.10% | 44.30% | 15.27% | NA |
| Indica III | 913 | 62.90% | 1.90% | 29.57% | 5.70% | NA |
| Indica Intermediate | 786 | 57.90% | 1.80% | 34.35% | 5.98% | NA |
| Temperate Japonica | 767 | 1.60% | 97.30% | 1.04% | 0.13% | NA |
| Tropical Japonica | 504 | 53.80% | 32.70% | 11.31% | 2.18% | NA |
| Japonica Intermediate | 241 | 21.60% | 71.00% | 7.05% | 0.41% | NA |
| VI/Aromatic | 96 | 76.00% | 0.00% | 23.96% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 31.10% | 20.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0815981055 | G -> T | LOC_Os08g26220.1 | downstream_gene_variant ; 3579.0bp to feature; MODIFIER | silent_mutation | Average:35.189; most accessible tissue: Minghui63 root, score: 51.763 | N | N | N | N |
| vg0815981055 | G -> T | LOC_Os08g26230.2 | downstream_gene_variant ; 3111.0bp to feature; MODIFIER | silent_mutation | Average:35.189; most accessible tissue: Minghui63 root, score: 51.763 | N | N | N | N |
| vg0815981055 | G -> T | LOC_Os08g26220.2 | downstream_gene_variant ; 3620.0bp to feature; MODIFIER | silent_mutation | Average:35.189; most accessible tissue: Minghui63 root, score: 51.763 | N | N | N | N |
| vg0815981055 | G -> T | LOC_Os08g26230.5 | downstream_gene_variant ; 3111.0bp to feature; MODIFIER | silent_mutation | Average:35.189; most accessible tissue: Minghui63 root, score: 51.763 | N | N | N | N |
| vg0815981055 | G -> T | LOC_Os08g26230.6 | downstream_gene_variant ; 3111.0bp to feature; MODIFIER | silent_mutation | Average:35.189; most accessible tissue: Minghui63 root, score: 51.763 | N | N | N | N |
| vg0815981055 | G -> T | LOC_Os08g26220-LOC_Os08g26230 | intergenic_region ; MODIFIER | silent_mutation | Average:35.189; most accessible tissue: Minghui63 root, score: 51.763 | N | N | N | N |
| vg0815981055 | G -> DEL | N | N | silent_mutation | Average:35.189; most accessible tissue: Minghui63 root, score: 51.763 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0815981055 | NA | 4.31E-06 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815981055 | NA | 3.76E-17 | mr1308 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815981055 | NA | 2.33E-09 | mr1308 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815981055 | NA | 3.61E-08 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815981055 | NA | 5.10E-08 | mr1308_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815981055 | NA | 1.24E-20 | mr1361_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815981055 | NA | 6.79E-11 | mr1361_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815981055 | NA | 2.36E-11 | mr1368_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815981055 | NA | 3.38E-08 | mr1401_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815981055 | NA | 2.54E-10 | mr1584_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815981055 | NA | 2.27E-06 | mr1853_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |