\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815900819:

Variant ID: vg0815900819 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 15900819
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGGCACGGCCGGACGGCGCGCGGGCGAGGCGGGAGAGGCGGCTGGAGGCGGCCGGCGGCACGGGAGAGAGAGGAAGACGGCGGGGAGAGGTGGTACGAC[G/C]
TCGGGGAGGCTCGGGATGAGGCTAAAACTATAGAACGGAGGATGGGGATTCCATTTTATAGGCACGGGGAGGGAGCCGGCCACGGGAGGAGCGGGGAACG

Reverse complement sequence

CGTTCCCCGCTCCTCCCGTGGCCGGCTCCCTCCCCGTGCCTATAAAATGGAATCCCCATCCTCCGTTCTATAGTTTTAGCCTCATCCCGAGCCTCCCCGA[C/G]
GTCGTACCACCTCTCCCCGCCGTCTTCCTCTCTCTCCCGTGCCGCCGGCCGCCTCCAGCCGCCTCTCCCGCCTCGCCCGCGCGCCGTCCGGCCGTGCCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.70% 12.70% 7.15% 9.48% NA
All Indica  2759 80.40% 0.90% 8.55% 10.08% NA
All Japonica  1512 49.50% 37.00% 4.50% 8.93% NA
Aus  269 79.90% 0.00% 10.78% 9.29% NA
Indica I  595 71.30% 1.70% 15.63% 11.43% NA
Indica II  465 72.90% 1.50% 10.32% 15.27% NA
Indica III  913 88.30% 0.10% 3.83% 7.78% NA
Indica Intermediate  786 82.70% 1.00% 7.63% 8.65% NA
Temperate Japonica  767 22.00% 65.60% 6.00% 6.39% NA
Tropical Japonica  504 84.10% 2.60% 2.58% 10.71% NA
Japonica Intermediate  241 64.70% 18.30% 3.73% 13.28% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 68.90% 15.60% 5.56% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0815900819 G -> C LOC_Os08g26140.1 downstream_gene_variant ; 2968.0bp to feature; MODIFIER silent_mutation Average:88.255; most accessible tissue: Zhenshan97 flag leaf, score: 97.138 N N N N
vg0815900819 G -> C LOC_Os08g26120-LOC_Os08g26140 intergenic_region ; MODIFIER silent_mutation Average:88.255; most accessible tissue: Zhenshan97 flag leaf, score: 97.138 N N N N
vg0815900819 G -> DEL N N silent_mutation Average:88.255; most accessible tissue: Zhenshan97 flag leaf, score: 97.138 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0815900819 G C 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0815900819 NA 4.54E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815900819 NA 1.98E-12 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815900819 NA 6.84E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815900819 4.08E-06 NA mr1035 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815900819 NA 4.46E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815900819 NA 6.14E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815900819 NA 5.36E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815900819 NA 1.95E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815900819 NA 7.03E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815900819 NA 3.16E-13 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815900819 NA 2.77E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815900819 NA 2.13E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815900819 NA 9.65E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815900819 NA 2.42E-14 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815900819 NA 1.34E-07 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815900819 NA 9.45E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815900819 NA 1.60E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815900819 NA 5.72E-26 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815900819 NA 4.78E-32 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815900819 NA 3.10E-07 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815900819 NA 6.48E-07 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815900819 NA 4.95E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251