Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815842636:

Variant ID: vg0815842636 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 15842636
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTATATCGTCCTATTTAAGTTCTCACTATACGTAGAATAGTTAACCTGAAATTTGTATCGCTGAAACGCATATACTCTCTCCATTTTATATTATAAGCCA[T/C]
TTTGATTTTTTAGTCAACGTATTTAATTTGATCAAGCTTATACAAAAAATATCACATTTACAACACCAAATTAGTTTTCTTAAATCTAACATTAAATATA

Reverse complement sequence

TATATTTAATGTTAGATTTAAGAAAACTAATTTGGTGTTGTAAATGTGATATTTTTTGTATAAGCTTGATCAAATTAAATACGTTGACTAAAAAATCAAA[A/G]
TGGCTTATAATATAAAATGGAGAGAGTATATGCGTTTCAGCGATACAAATTTCAGGTTAACTATTCTACGTATAGTGAGAACTTAAATAGGACGATATAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.90%	18.50%	0.19%	4.46%	NA
All Indica	2759	91.70%	0.60%	0.33%	7.32%	NA
All Japonica	1512	44.20%	55.30%	0.00%	0.53%	NA
Aus	269	98.90%	0.70%	0.00%	0.37%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	95.30%	1.10%	0.22%	3.44%	NA
Indica III	913	84.20%	0.10%	0.66%	15.01%	NA
Indica Intermediate	786	92.10%	1.40%	0.25%	6.23%	NA
Temperate Japonica	767	3.70%	96.10%	0.00%	0.26%	NA
Tropical Japonica	504	94.00%	4.80%	0.00%	1.19%	NA
Japonica Intermediate	241	68.90%	31.10%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	80.00%	20.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0815842636	T -> C	LOC_Os08g26030.1	upstream_gene_variant ; 4107.0bp to feature; MODIFIER	silent_mutation	Average:35.868; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N
vg0815842636	T -> C	LOC_Os08g26040.1	upstream_gene_variant ; 1569.0bp to feature; MODIFIER	silent_mutation	Average:35.868; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N
vg0815842636	T -> C	LOC_Os08g26050.1	downstream_gene_variant ; 770.0bp to feature; MODIFIER	silent_mutation	Average:35.868; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N
vg0815842636	T -> C	LOC_Os08g26040-LOC_Os08g26050	intergenic_region ; MODIFIER	silent_mutation	Average:35.868; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N
vg0815842636	T -> DEL	N	N	silent_mutation	Average:35.868; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0815842636	NA	4.05E-24	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	1.48E-11	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	1.09E-52	mr1241	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	3.18E-11	mr1241	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	2.65E-21	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	2.20E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	1.36E-08	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	9.54E-38	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	2.07E-20	mr1584	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	3.58E-07	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	4.06E-07	mr1599	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	1.53E-25	mr1611	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	4.25E-13	mr1611	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	5.58E-36	mr1784	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	1.43E-32	mr1789	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	5.07E-14	mr1844	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	2.44E-07	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	1.54E-06	mr1870	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	3.09E-13	mr1879	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	3.38E-24	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	7.83E-18	mr1156_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	3.76E-13	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	1.41E-58	mr1241_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	4.35E-24	mr1308_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	2.56E-08	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	1.20E-25	mr1361_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	5.69E-12	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	3.97E-08	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	7.79E-36	mr1368_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	2.31E-11	mr1368_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	3.15E-22	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	6.42E-08	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	1.27E-08	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	4.62E-44	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	8.72E-30	mr1584_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	3.44E-10	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	1.34E-07	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	1.21E-14	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	2.73E-07	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	3.68E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	1.93E-08	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815842636	NA	4.35E-18	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251