\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815800560:

Variant ID: vg0815800560 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 15800560
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, G: 0.10, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGTGCTCAAGGATCTACTACTATTTCATCCAGCCTCGTCGACAACAGCGTCAACGCCAACCTCAACTACGAGCTTCCTGCCTCGACGACGCTTACGTG[C/G]
ACTCAAGTCGGCGAAATTGTCTTTCCGGTTTACACCATGATGCCGATCTCAGCTGGGCCGTCGAGGACCAGAAACGAGAACGCAGTGGCTGTAGCCCAAG

Reverse complement sequence

CTTGGGCTACAGCCACTGCGTTCTCGTTTCTGGTCCTCGACGGCCCAGCTGAGATCGGCATCATGGTGTAAACCGGAAAGACAATTTCGCCGACTTGAGT[G/C]
CACGTAAGCGTCGTCGAGGCAGGAAGCTCGTAGTTGAGGTTGGCGTTGACGCTGTTGTCGACGAGGCTGGATGAAATAGTAGTAGATCCTTGAGCACCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.60% 23.50% 0.25% 13.69% NA
All Indica  2759 67.40% 10.10% 0.43% 22.11% NA
All Japonica  1512 58.20% 41.40% 0.00% 0.40% NA
Aus  269 58.40% 31.20% 0.00% 10.41% NA
Indica I  595 99.00% 0.00% 0.00% 1.01% NA
Indica II  465 72.30% 4.10% 0.22% 23.44% NA
Indica III  913 44.60% 18.70% 0.66% 36.04% NA
Indica Intermediate  786 67.00% 11.20% 0.64% 21.12% NA
Temperate Japonica  767 97.30% 2.30% 0.00% 0.39% NA
Tropical Japonica  504 6.30% 93.50% 0.00% 0.20% NA
Japonica Intermediate  241 42.30% 56.80% 0.00% 0.83% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 60.00% 36.70% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0815800560 C -> G LOC_Os08g25970.1 upstream_gene_variant ; 40.0bp to feature; MODIFIER silent_mutation Average:69.756; most accessible tissue: Minghui63 young leaf, score: 88.992 N N N N
vg0815800560 C -> G LOC_Os08g25960-LOC_Os08g25970 intergenic_region ; MODIFIER silent_mutation Average:69.756; most accessible tissue: Minghui63 young leaf, score: 88.992 N N N N
vg0815800560 C -> DEL N N silent_mutation Average:69.756; most accessible tissue: Minghui63 young leaf, score: 88.992 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0815800560 C G 0.01 0.02 0.02 0.02 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0815800560 NA 3.54E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815800560 NA 9.60E-08 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815800560 NA 9.79E-12 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815800560 NA 2.20E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815800560 7.59E-07 5.23E-08 mr1484 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815800560 NA 1.31E-12 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815800560 NA 2.69E-07 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815800560 NA 3.36E-13 mr1789 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815800560 NA 1.73E-06 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815800560 NA 2.26E-09 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815800560 NA 7.85E-07 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815800560 NA 8.98E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815800560 NA 1.27E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815800560 NA 3.83E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815800560 NA 3.75E-09 mr1454_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815800560 NA 2.89E-07 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815800560 NA 1.35E-08 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815800560 NA 8.77E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815800560 NA 2.31E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815800560 NA 2.41E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815800560 NA 2.71E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251