| Variant ID: vg0815798149 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 15798149 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 263. )
TGGAATACTCCGTAGGGGAAGCGCTACAGTGGTATATTCGTGCGCTTGCGGATTCTATCTGTGATCGTAAGAAATACCAACACTCATCTCTATCGGGTAG[T/C]
GCCCCCGTCACTAAGCAAAGGTCACTAATGTGAGAAAATATCTCAATCGGGCATCCGGCCATCACGGATGACACACATCTCAATCGGGCCTAAATTATAG
CTATAATTTAGGCCCGATTGAGATGTGTGTCATCCGTGATGGCCGGATGCCCGATTGAGATATTTTCTCACATTAGTGACCTTTGCTTAGTGACGGGGGC[A/G]
CTACCCGATAGAGATGAGTGTTGGTATTTCTTACGATCACAGATAGAATCCGCAAGCGCACGAATATACCACTGTAGCGCTTCCCCTACGGAGTATTCCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.00% | 11.60% | 0.38% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.20% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 64.40% | 34.80% | 0.79% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.20% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 39.80% | 58.80% | 1.43% | 0.00% | NA |
| Tropical Japonica | 504 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.60% | 22.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0815798149 | T -> C | LOC_Os08g25960.1 | upstream_gene_variant ; 2739.0bp to feature; MODIFIER | silent_mutation | Average:53.497; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 | N | N | N | N |
| vg0815798149 | T -> C | LOC_Os08g25970.1 | upstream_gene_variant ; 2451.0bp to feature; MODIFIER | silent_mutation | Average:53.497; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 | N | N | N | N |
| vg0815798149 | T -> C | LOC_Os08g25960-LOC_Os08g25970 | intergenic_region ; MODIFIER | silent_mutation | Average:53.497; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0815798149 | NA | 3.81E-06 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815798149 | 2.65E-06 | NA | mr1806 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815798149 | 2.77E-06 | 2.77E-06 | mr1806 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815798149 | NA | 9.63E-07 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |