Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815752681:

Variant ID: vg0815752681 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 15752681
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAGTTTAATAGTATAGCCCACTACTGGCTCCAATTCATCTATAGCCAATCTAATAGCCAATTCATACAATAATCATTTACTATACTATTAATATATGGT[T/C]
CCACATGTCATACACACACTGCGTCTTAGAGTCCGTGCTGCAGCTGGCTACAGATCTGTAGACCGCTCCTCTTCCCTCTCATCTTTTATCTCATTAAAAT

Reverse complement sequence

ATTTTAATGAGATAAAAGATGAGAGGGAAGAGGAGCGGTCTACAGATCTGTAGCCAGCTGCAGCACGGACTCTAAGACGCAGTGTGTGTATGACATGTGG[A/G]
ACCATATATTAATAGTATAGTAAATGATTATTGTATGAATTGGCTATTAGATTGGCTATAGATGAATTGGAGCCAGTAGTGGGCTATACTATTAAACTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.40%	17.40%	0.15%	0.00%	NA
All Indica	2759	99.40%	0.40%	0.18%	0.00%	NA
All Japonica	1512	47.40%	52.50%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	99.10%	0.40%	0.43%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.70%	1.10%	0.13%	0.00%	NA
Temperate Japonica	767	8.30%	91.50%	0.13%	0.00%	NA
Tropical Japonica	504	94.80%	5.20%	0.00%	0.00%	NA
Japonica Intermediate	241	72.20%	27.40%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0815752681	T -> C	LOC_Os08g25864.1	downstream_gene_variant ; 2779.0bp to feature; MODIFIER	silent_mutation	Average:43.032; most accessible tissue: Zhenshan97 young leaf, score: 57.159	N	N	N	N
vg0815752681	T -> C	LOC_Os08g25860.1	intron_variant ; MODIFIER	silent_mutation	Average:43.032; most accessible tissue: Zhenshan97 young leaf, score: 57.159	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0815752681	NA	7.66E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815752681	NA	5.03E-22	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815752681	NA	1.20E-11	mr1241	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815752681	NA	4.03E-10	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815752681	NA	7.83E-06	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815752681	NA	5.41E-08	mr1599	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815752681	NA	1.29E-20	mr1689	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815752681	NA	2.21E-06	mr1689	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815752681	NA	3.67E-29	mr1789	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815752681	NA	1.77E-12	mr1844	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815752681	NA	6.83E-16	mr1879	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815752681	NA	1.32E-13	mr1879	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815752681	NA	1.06E-14	mr1031_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815752681	NA	1.17E-07	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815752681	NA	1.45E-06	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815752681	NA	5.33E-21	mr1308_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815752681	NA	1.30E-21	mr1361_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815752681	NA	1.56E-32	mr1368_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815752681	NA	2.65E-28	mr1789_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815752681	NA	1.96E-13	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815752681	NA	7.01E-06	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815752681	NA	1.71E-12	mr1879_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251