\
| Variant ID: vg0815721034 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 15721034 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTCGTCCGGGGCTCGAAGAGAGAGCTTGTGCTCCTACCTGCGACCCGAAGATGGCTAGCCTTGGTTTCTAGATGGCTACCACACCCGAGGGCGTCCTCGG[C/T]
TCCCGGGGCACCTGGCGTGTTCAGAGTATTCCTGGACACCTGGTTTTTCTCCTTGGCGTCTTGAAGATGCATGTCTTGTTTGCCTCGTTGTATTCTACCG
CGGTAGAATACAACGAGGCAAACAAGACATGCATCTTCAAGACGCCAAGGAGAAAAACCAGGTGTCCAGGAATACTCTGAACACGCCAGGTGCCCCGGGA[G/A]
CCGAGGACGCCCTCGGGTGTGGTAGCCATCTAGAAACCAAGGCTAGCCATCTTCGGGTCGCAGGTAGGAGCACAAGCTCTCTCTTCGAGCCCCGGACGAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.70% | 13.30% | 0.97% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.20% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 56.90% | 40.20% | 2.84% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 32.90% | 62.20% | 4.95% | 0.00% | NA |
| Tropical Japonica | 504 | 89.30% | 10.50% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.00% | 32.40% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 16.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0815721034 | C -> T | LOC_Os08g25820.1 | downstream_gene_variant ; 4508.0bp to feature; MODIFIER | silent_mutation | Average:66.842; most accessible tissue: Zhenshan97 young leaf, score: 83.623 | N | N | N | N |
| vg0815721034 | C -> T | LOC_Os08g25830.1 | downstream_gene_variant ; 2017.0bp to feature; MODIFIER | silent_mutation | Average:66.842; most accessible tissue: Zhenshan97 young leaf, score: 83.623 | N | N | N | N |
| vg0815721034 | C -> T | LOC_Os08g25820.2 | downstream_gene_variant ; 4508.0bp to feature; MODIFIER | silent_mutation | Average:66.842; most accessible tissue: Zhenshan97 young leaf, score: 83.623 | N | N | N | N |
| vg0815721034 | C -> T | LOC_Os08g25830-LOC_Os08g25839 | intergenic_region ; MODIFIER | silent_mutation | Average:66.842; most accessible tissue: Zhenshan97 young leaf, score: 83.623 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0815721034 | NA | 7.52E-06 | mr1029 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815721034 | 1.21E-06 | NA | mr1125 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815721034 | NA | 9.55E-08 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815721034 | 9.38E-07 | 2.54E-07 | mr1343 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815721034 | 2.13E-06 | 2.12E-06 | mr1343 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815721034 | NA | 9.63E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815721034 | 1.14E-06 | 2.85E-06 | mr1621 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815721034 | 1.73E-07 | 1.73E-07 | mr1621 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815721034 | NA | 6.13E-09 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815721034 | 7.42E-06 | NA | mr1806 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815721034 | 2.81E-06 | 2.81E-06 | mr1806 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815721034 | NA | 7.52E-09 | mr1471_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815721034 | NA | 1.06E-07 | mr1526_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |