Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815690898:

Variant ID: vg0815690898 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 15690898
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTCTCTTTGCGTCCGCATGTTCGCATGCGGTTGCTCTGGCCGCATGCAAAGATCGTCATCCTTGCAGATGATTTCGCGCATATGGTCGGACCAACC[G/A]
CATGCGAAAATCGTTTTCGTCCACATGCAAAGACGACTTCTGTAGTAGTGCGACGCACCCGAGCGCTGCCGTCCCTGCTCGAACCCGTGCGGCGTGACCA

Reverse complement sequence

TGGTCACGCCGCACGGGTTCGAGCAGGGACGGCAGCGCTCGGGTGCGTCGCACTACTACAGAAGTCGTCTTTGCATGTGGACGAAAACGATTTTCGCATG[C/T]
GGTTGGTCCGACCATATGCGCGAAATCATCTGCAAGGATGACGATCTTTGCATGCGGCCAGAGCAACCGCATGCGAACATGCGGACGCAAAGAGAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.70% 29.30% 0.02% 0.00% NA
All Indica  2759 96.70% 3.30% 0.00% 0.00% NA
All Japonica  1512 31.20% 68.80% 0.00% 0.00% NA
Aus  269 39.00% 61.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 96.60% 3.40% 0.00% 0.00% NA
Indica Intermediate  786 94.10% 5.90% 0.00% 0.00% NA
Temperate Japonica  767 4.80% 95.20% 0.00% 0.00% NA
Tropical Japonica  504 58.30% 41.70% 0.00% 0.00% NA
Japonica Intermediate  241 58.50% 41.50% 0.00% 0.00% NA
VI/Aromatic  96 52.10% 47.90% 0.00% 0.00% NA
Intermediate  90 52.20% 46.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0815690898 G -> A LOC_Os08g25799.1 upstream_gene_variant ; 4636.0bp to feature; MODIFIER silent_mutation Average:83.85; most accessible tissue: Zhenshan97 panicle, score: 92.133 N N N N
vg0815690898 G -> A LOC_Os08g25770.1 downstream_gene_variant ; 2338.0bp to feature; MODIFIER silent_mutation Average:83.85; most accessible tissue: Zhenshan97 panicle, score: 92.133 N N N N
vg0815690898 G -> A LOC_Os08g25780.1 intron_variant ; MODIFIER silent_mutation Average:83.85; most accessible tissue: Zhenshan97 panicle, score: 92.133 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0815690898 G A 0.03 0.02 0.01 0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0815690898 NA 1.30E-18 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0815690898 NA 4.57E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815690898 NA 2.89E-25 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815690898 NA 1.27E-09 mr1509_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815690898 NA 5.08E-10 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251