Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0815688098:

Variant ID: vg0815688098 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 15688098
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, T: 0.14, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGACGAAAGCAGAATGGTTGACAAATTAGTTGGAGGACGATCTTCAGTGTTTGGTTGGCTGATAGGCAGGCTTTACATAGACAACTGTAGAAAAAGTC[C/T]
AGTTTACATCCTTTAATATAGGCTGAGTTTCATTTGCATCTCTCGACTGTAAAACCGGATAGATCGTCCTCCAACTATTAAAATTTAAAACCAATGTAAA

Reverse complement sequence

TTTACATTGGTTTTAAATTTTAATAGTTGGAGGACGATCTATCCGGTTTTACAGTCGAGAGATGCAAATGAAACTCAGCCTATATTAAAGGATGTAAACT[G/A]
GACTTTTTCTACAGTTGTCTATGTAAAGCCTGCCTATCAGCCAACCAAACACTGAAGATCGTCCTCCAACTAATTTGTCAACCATTCTGCTTTCGTCCTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.80% 37.10% 0.02% 0.00% NA
All Indica  2759 96.70% 3.30% 0.00% 0.00% NA
All Japonica  1512 4.70% 95.20% 0.07% 0.00% NA
Aus  269 71.00% 29.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 96.90% 3.10% 0.00% 0.00% NA
Indica Intermediate  786 94.30% 5.70% 0.00% 0.00% NA
Temperate Japonica  767 2.60% 97.40% 0.00% 0.00% NA
Tropical Japonica  504 4.60% 95.40% 0.00% 0.00% NA
Japonica Intermediate  241 11.60% 88.00% 0.41% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 38.90% 61.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0815688098 C -> T LOC_Os08g25760.1 upstream_gene_variant ; 4993.0bp to feature; MODIFIER silent_mutation Average:72.731; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0815688098 C -> T LOC_Os08g25780.1 upstream_gene_variant ; 2174.0bp to feature; MODIFIER silent_mutation Average:72.731; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0815688098 C -> T LOC_Os08g25770.1 intron_variant ; MODIFIER silent_mutation Average:72.731; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0815688098 C T -0.05 -0.02 -0.02 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0815688098 NA 6.84E-06 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 NA 2.36E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 NA 1.32E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 NA 3.23E-12 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 NA 3.26E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 NA 3.66E-24 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 NA 1.28E-27 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 NA 8.99E-35 mr1081_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 NA 3.60E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 3.00E-07 8.99E-44 mr1092_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 8.71E-07 4.85E-13 mr1097_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 NA 4.48E-13 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 NA 2.77E-17 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 1.97E-07 3.70E-44 mr1152_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 3.79E-07 3.54E-55 mr1154_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 NA 2.53E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 NA 1.11E-09 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 NA 1.06E-14 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 NA 1.92E-36 mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 NA 1.72E-35 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 NA 1.38E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 NA 3.41E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 NA 1.15E-07 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 NA 1.48E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 4.03E-06 NA mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 NA 5.17E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815688098 NA 1.29E-40 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251