Variant ID: vg0815684621 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 15684621 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGACCGCTCTATTTTCCGTGCGGAGGGTCTCATCCAGGATCTCCGAACGCAGCTTAAGGCTGTGTTTGGAACCTTGGGATGGGAACTCATTCCCTCTGCA[T/C]
GGAAAACGGAGCGATCCATTAGAGCGCGATTAATTAAGTATTAGTTATTTTTTAAAAAAAATGGATTAATATAATTTTTTAAAGCAACTTTTGTATAAAA
TTTTATACAAAAGTTGCTTTAAAAAATTATATTAATCCATTTTTTTTAAAAAATAACTAATACTTAATTAATCGCGCTCTAATGGATCGCTCCGTTTTCC[A/G]
TGCAGAGGGAATGAGTTCCCATCCCAAGGTTCCAAACACAGCCTTAAGCTGCGTTCGGAGATCCTGGATGAGACCCTCCGCACGGAAAATAGAGCGGTCT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 81.00% | 19.00% | 0.00% | 0.00% | NA |
All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 42.70% | 57.30% | 0.00% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 4.70% | 95.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 89.90% | 10.10% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 64.70% | 35.30% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0815684621 | T -> C | LOC_Os08g25750.1 | upstream_gene_variant ; 4740.0bp to feature; MODIFIER | silent_mutation | Average:56.886; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | N | N | N | N |
vg0815684621 | T -> C | LOC_Os08g25760.1 | upstream_gene_variant ; 1516.0bp to feature; MODIFIER | silent_mutation | Average:56.886; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | N | N | N | N |
vg0815684621 | T -> C | LOC_Os08g25770.1 | upstream_gene_variant ; 2791.0bp to feature; MODIFIER | silent_mutation | Average:56.886; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | N | N | N | N |
vg0815684621 | T -> C | LOC_Os08g25760-LOC_Os08g25770 | intergenic_region ; MODIFIER | silent_mutation | Average:56.886; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0815684621 | NA | 4.50E-06 | mr1087 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815684621 | NA | 4.37E-23 | mr1115 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815684621 | NA | 5.27E-06 | mr1295 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815684621 | NA | 1.67E-07 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815684621 | NA | 2.28E-09 | mr1368 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815684621 | NA | 2.94E-06 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815684621 | NA | 1.16E-09 | mr1449 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815684621 | NA | 2.18E-12 | mr1454 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815684621 | NA | 2.39E-10 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815684621 | NA | 3.85E-43 | mr1486 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/