| Variant ID: vg0815683726 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 15683726 |
| Reference Allele: T | Alternative Allele: C,G |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 254. )
CGGTCGGCGAAGAAGATGGCGGAGCCCGCATGCGCACTGATGGCGAGGGAGGCCGAGAACGGCATCCATGATCCAATGAAAGGTAGGCATCGTACCTTCT[T/C,G]
TGATGATTCTTCTGTTCGCTTTTCTGTTAGATCAAAAGCGATGGTTTCCTTCTTTCACTTCGCGATCTCCTTCACGAGAGCGAAAGTGGTGATAACGTGT
ACACGTTATCACCACTTTCGCTCTCGTGAAGGAGATCGCGAAGTGAAAGAAGGAAACCATCGCTTTTGATCTAACAGAAAAGCGAACAGAAGAATCATCA[A/G,C]
AGAAGGTACGATGCCTACCTTTCATTGGATCATGGATGCCGTTCTCGGCCTCCCTCGCCATCAGTGCGCATGCGGGCTCCGCCATCTTCTTCGCCGACCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.80% | 29.20% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 15.90% | 84.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 35.10% | 64.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 18.70% | 81.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 49.00% | 51.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 33.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0815683726 | T -> G | LOC_Os08g25750.1 | upstream_gene_variant ; 3845.0bp to feature; MODIFIER | N | Average:59.263; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 | N | N | N | N |
| vg0815683726 | T -> G | LOC_Os08g25760.1 | upstream_gene_variant ; 621.0bp to feature; MODIFIER | N | Average:59.263; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 | N | N | N | N |
| vg0815683726 | T -> G | LOC_Os08g25770.1 | upstream_gene_variant ; 3686.0bp to feature; MODIFIER | N | Average:59.263; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 | N | N | N | N |
| vg0815683726 | T -> G | LOC_Os08g25760-LOC_Os08g25770 | intergenic_region ; MODIFIER | N | Average:59.263; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 | N | N | N | N |
| vg0815683726 | T -> C | LOC_Os08g25750.1 | upstream_gene_variant ; 3845.0bp to feature; MODIFIER | silent_mutation | Average:59.263; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 | N | N | N | N |
| vg0815683726 | T -> C | LOC_Os08g25760.1 | upstream_gene_variant ; 621.0bp to feature; MODIFIER | silent_mutation | Average:59.263; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 | N | N | N | N |
| vg0815683726 | T -> C | LOC_Os08g25770.1 | upstream_gene_variant ; 3686.0bp to feature; MODIFIER | silent_mutation | Average:59.263; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 | N | N | N | N |
| vg0815683726 | T -> C | LOC_Os08g25760-LOC_Os08g25770 | intergenic_region ; MODIFIER | silent_mutation | Average:59.263; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0815683726 | NA | 4.63E-29 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815683726 | NA | 4.14E-40 | mr1124 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815683726 | 9.86E-06 | NA | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815683726 | 1.10E-08 | 1.23E-49 | mr1136 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815683726 | NA | 1.36E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815683726 | NA | 1.68E-10 | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815683726 | NA | 9.84E-30 | mr1202 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815683726 | NA | 1.15E-22 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815683726 | NA | 3.67E-20 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815683726 | NA | 5.23E-10 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815683726 | NA | 1.64E-07 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |