Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815683508:

Variant ID: vg0815683508 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 15683508
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTGTCACCACTGCCGTCCATCCGTGGTAGGCGCAGTACTGCACCCCCTGCACAAGGATCCGGTGAGGTGCTTCAGCAACCGGAGGCGGAGGAGGAGGCG[C/T]
GACAGGGACGGGCGGGGGAACCACGACCGGAGTTGCAGTCACACGGCGGCAAGGGTAGTGGCGGCAGCCACCAACCCTAGCCCTGCCTCCGCGGGATCCC

Reverse complement sequence

GGGATCCCGCGGAGGCAGGGCTAGGGTTGGTGGCTGCCGCCACTACCCTTGCCGCCGTGTGACTGCAACTCCGGTCGTGGTTCCCCCGCCCGTCCCTGTC[G/A]
CGCCTCCTCCTCCGCCTCCGGTTGCTGAAGCACCTCACCGGATCCTTGTGCAGGGGGTGCAGTACTGCGCCTACCACGGATGGACGGCAGTGGTGACACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.50% 38.50% 0.02% 0.00% NA
All Indica  2759 95.50% 4.50% 0.04% 0.00% NA
All Japonica  1512 2.60% 97.40% 0.00% 0.00% NA
Aus  269 70.60% 29.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 94.30% 5.70% 0.00% 0.00% NA
Indica Intermediate  786 93.00% 6.90% 0.13% 0.00% NA
Temperate Japonica  767 2.50% 97.50% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 38.90% 61.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0815683508 C -> T LOC_Os08g25750.1 upstream_gene_variant ; 3627.0bp to feature; MODIFIER silent_mutation Average:71.963; most accessible tissue: Zhenshan97 flag leaf, score: 84.998 N N N N
vg0815683508 C -> T LOC_Os08g25760.1 upstream_gene_variant ; 403.0bp to feature; MODIFIER silent_mutation Average:71.963; most accessible tissue: Zhenshan97 flag leaf, score: 84.998 N N N N
vg0815683508 C -> T LOC_Os08g25770.1 upstream_gene_variant ; 3904.0bp to feature; MODIFIER silent_mutation Average:71.963; most accessible tissue: Zhenshan97 flag leaf, score: 84.998 N N N N
vg0815683508 C -> T LOC_Os08g25760-LOC_Os08g25770 intergenic_region ; MODIFIER silent_mutation Average:71.963; most accessible tissue: Zhenshan97 flag leaf, score: 84.998 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0815683508 C T -0.01 -0.01 -0.01 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0815683508 NA 2.70E-66 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 NA 6.81E-45 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 NA 2.36E-58 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 NA 4.48E-12 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 NA 6.39E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 NA 3.93E-24 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 NA 7.16E-27 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 NA 2.37E-34 mr1081_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 NA 1.42E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 1.70E-06 8.52E-44 mr1092_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 2.76E-06 3.72E-13 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 NA 5.55E-13 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 NA 2.17E-16 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 1.47E-06 4.45E-44 mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 4.30E-07 6.69E-56 mr1154_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 NA 6.67E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 NA 4.68E-09 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 NA 5.36E-14 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 NA 3.99E-35 mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 NA 1.54E-34 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 NA 1.88E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 NA 1.37E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 NA 3.09E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 NA 1.68E-19 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815683508 NA 3.12E-41 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251