| Variant ID: vg0815679964 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 15679964 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AATAATTTTTCTCATCATCCCGATACCGGGGTGCCCAAGTCGATCATGCCAAGTGTGGAATGCATTAACATTTTGAAAAATTACTTTGTACGCAACATGT[A/G]
CAATGGGCTTAATGTATGTATAGTACAATCCTGATGTGAGAGATGGAATTTTCTCGCAAATGCGTTTGCCATATCCGTTTTGTTTGGTTAAGAGAATAAA
TTTATTCTCTTAACCAAACAAAACGGATATGGCAAACGCATTTGCGAGAAAATTCCATCTCTCACATCAGGATTGTACTATACATACATTAAGCCCATTG[T/C]
ACATGTTGCGTACAAAGTAATTTTTCAAAATGTTAATGCATTCCACACTTGGCATGATCGACTTGGGCACCCCGGTATCGGGATGATGAGAAAAATTATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.00% | 12.70% | 6.16% | 1.14% | NA |
| All Indica | 2759 | 89.90% | 0.20% | 7.90% | 1.96% | NA |
| All Japonica | 1512 | 57.30% | 38.20% | 4.50% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 88.60% | 0.00% | 9.75% | 1.68% | NA |
| Indica II | 465 | 87.10% | 0.40% | 10.54% | 1.94% | NA |
| Indica III | 913 | 90.70% | 0.20% | 6.90% | 2.19% | NA |
| Indica Intermediate | 786 | 91.70% | 0.30% | 6.11% | 1.91% | NA |
| Temperate Japonica | 767 | 32.60% | 59.50% | 7.95% | 0.00% | NA |
| Tropical Japonica | 504 | 89.90% | 9.70% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.00% | 29.90% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 15.60% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0815679964 | A -> G | LOC_Os08g25750.1 | upstream_gene_variant ; 83.0bp to feature; MODIFIER | silent_mutation | Average:22.297; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0815679964 | A -> G | LOC_Os08g25760.1 | downstream_gene_variant ; 686.0bp to feature; MODIFIER | silent_mutation | Average:22.297; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0815679964 | A -> G | LOC_Os08g25750-LOC_Os08g25760 | intergenic_region ; MODIFIER | silent_mutation | Average:22.297; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0815679964 | A -> DEL | N | N | silent_mutation | Average:22.297; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0815679964 | 4.83E-07 | NA | mr1125 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815679964 | 7.52E-06 | 3.50E-08 | mr1125 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815679964 | 4.77E-06 | 4.76E-06 | mr1621 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815679964 | NA | 7.74E-09 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815679964 | NA | 5.70E-10 | mr1471_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |