Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815676317:

Variant ID: vg0815676317 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 15676317
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

ACACAAATAGAGCGAATCGATCGATTTCTCATTGATCAACAGTACATTTATACAATGTAAAGCTGTGTCAACCGCAGGGGACGCGATGTTTGGGAACATC[G/A]
CGACGGTTGTCGAGAGGGATGCCAAAGGGAGAGAGAGGAGAGCGATCTCCTCTTCTCAACCGGTTAGATTAGGAACCGTTGTTCCTATTTCCTTGGGTGG

Reverse complement sequence

CCACCCAAGGAAATAGGAACAACGGTTCCTAATCTAACCGGTTGAGAAGAGGAGATCGCTCTCCTCTCTCTCCCTTTGGCATCCCTCTCGACAACCGTCG[C/T]
GATGTTCCCAAACATCGCGTCCCCTGCGGTTGACACAGCTTTACATTGTATAAATGTACTGTTGATCAATGAGAAATCGATCGATTCGCTCTATTTGTGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.50%	9.90%	0.59%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.04%	0.00%	NA
All Japonica	1512	71.80%	26.50%	1.65%	0.00%	NA
Aus	269	98.90%	0.40%	0.74%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.30%	0.13%	0.00%	NA
Temperate Japonica	767	94.70%	2.20%	3.13%	0.00%	NA
Tropical Japonica	504	45.60%	54.40%	0.00%	0.00%	NA
Japonica Intermediate	241	53.90%	45.60%	0.41%	0.00%	NA
VI/Aromatic	96	50.00%	50.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0815676317	G -> A	LOC_Os08g25734.2	upstream_gene_variant ; 3723.0bp to feature; MODIFIER	silent_mutation	Average:65.212; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0815676317	G -> A	LOC_Os08g25750.1	downstream_gene_variant ; 493.0bp to feature; MODIFIER	silent_mutation	Average:65.212; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0815676317	G -> A	LOC_Os08g25760.1	downstream_gene_variant ; 4333.0bp to feature; MODIFIER	silent_mutation	Average:65.212; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0815676317	G -> A	LOC_Os08g25734-LOC_Os08g25750	intergenic_region ; MODIFIER	silent_mutation	Average:65.212; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0815676317	3.46E-07	NA	Grain_width	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0815676317	NA	6.87E-07	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815676317	NA	3.44E-13	mr1330	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815676317	NA	4.49E-10	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815676317	NA	9.67E-14	mr1454	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815676317	NA	4.52E-08	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815676317	NA	4.43E-07	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815676317	NA	4.80E-07	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815676317	NA	5.20E-07	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815676317	NA	1.59E-09	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251