Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815665575:

Variant ID: vg0815665575 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 15665575
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCATTCATAGATCAATGGATAAGATTCATTGCTACAACTCGTGAACAATGAAAAGAAGCATGGTTTGTATGGTACTTGGGGCATCGTTCAGTAAACTCAT[A/T]
CTCTCTCCGTTTCTAAATATCTGACGCCGTTGATTTTTTTAAATATGTTTGACTATTCGTCCTATTCAAAAAATTAAAGTAATTATTAATTCTTTCCCTA

Reverse complement sequence

TAGGGAAAGAATTAATAATTACTTTAATTTTTTGAATAGGACGAATAGTCAAACATATTTAAAAAAATCAACGGCGTCAGATATTTAGAAACGGAGAGAG[T/A]
ATGAGTTTACTGAACGATGCCCCAAGTACCATACAAACCATGCTTCTTTTCATTGTTCACGAGTTGTAGCAATGAATCTTATCCATTGATCTATGAATGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.60%	4.30%	0.11%	0.00%	NA
All Indica	2759	92.70%	7.10%	0.18%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	96.10%	3.90%	0.00%	0.00%	NA
Indica III	913	85.40%	14.30%	0.22%	0.00%	NA
Indica Intermediate	786	93.60%	6.00%	0.38%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0815665575	A -> T	LOC_Os08g25720.1	downstream_gene_variant ; 1685.0bp to feature; MODIFIER	silent_mutation	Average:71.416; most accessible tissue: Callus, score: 91.309	N	N	N	N
vg0815665575	A -> T	LOC_Os08g25734.1	downstream_gene_variant ; 626.0bp to feature; MODIFIER	silent_mutation	Average:71.416; most accessible tissue: Callus, score: 91.309	N	N	N	N
vg0815665575	A -> T	LOC_Os08g25734.2	downstream_gene_variant ; 626.0bp to feature; MODIFIER	silent_mutation	Average:71.416; most accessible tissue: Callus, score: 91.309	N	N	N	N
vg0815665575	A -> T	LOC_Os08g25720-LOC_Os08g25734	intergenic_region ; MODIFIER	silent_mutation	Average:71.416; most accessible tissue: Callus, score: 91.309	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0815665575	2.01E-08	5.80E-11	mr1238	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815665575	5.18E-06	8.49E-08	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815665575	NA	1.04E-06	mr1484	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815665575	3.83E-07	2.05E-09	mr1841	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815665575	1.81E-07	9.23E-11	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815665575	1.91E-07	5.41E-11	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815665575	4.61E-07	7.57E-11	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815665575	NA	4.61E-08	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815665575	2.23E-06	2.23E-06	mr1945_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251