\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815655246:

Variant ID: vg0815655246 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 15655246
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTCTAGTAGGATACAAATTTAGGAACAGCTAAAATTTAGAATAAAAATATGAAATATTGAAAATAGTCCATTTAGAATAAAAACACGAGATTAATTAAA[A/G]
TTAAAAATAAAAATAAAAGAAATCCAAAATTAGAAAAGAAAAAGTTATGTACTTTAGAAATAACGAATAAAAATACAGAATATTAAAAAAGAGACCATCT

Reverse complement sequence

AGATGGTCTCTTTTTTAATATTCTGTATTTTTATTCGTTATTTCTAAAGTACATAACTTTTTCTTTTCTAATTTTGGATTTCTTTTATTTTTATTTTTAA[T/C]
TTTAATTAATCTCGTGTTTTTATTCTAAATGGACTATTTTCAATATTTCATATTTTTATTCTAAATTTTAGCTGTTCCTAAATTTGTATCCTACTAGAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 6.70% 0.00% 0.00% NA
All Indica  2759 98.50% 1.50% 0.00% 0.00% NA
All Japonica  1512 92.30% 7.70% 0.00% 0.00% NA
Aus  269 62.80% 37.20% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 98.50% 1.50% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 3.40% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 78.80% 21.20% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.70% 0.00% 0.00% NA
VI/Aromatic  96 56.20% 43.80% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0815655246 A -> G LOC_Os08g25720.1 upstream_gene_variant ; 3247.0bp to feature; MODIFIER silent_mutation Average:50.602; most accessible tissue: Zhenshan97 flower, score: 76.324 N N N N
vg0815655246 A -> G LOC_Os08g25710-LOC_Os08g25720 intergenic_region ; MODIFIER silent_mutation Average:50.602; most accessible tissue: Zhenshan97 flower, score: 76.324 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0815655246 7.71E-08 NA Awn_length All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0815655246 NA 1.39E-06 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251