\
| Variant ID: vg0815655246 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 15655246 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTTCTAGTAGGATACAAATTTAGGAACAGCTAAAATTTAGAATAAAAATATGAAATATTGAAAATAGTCCATTTAGAATAAAAACACGAGATTAATTAAA[A/G]
TTAAAAATAAAAATAAAAGAAATCCAAAATTAGAAAAGAAAAAGTTATGTACTTTAGAAATAACGAATAAAAATACAGAATATTAAAAAAGAGACCATCT
AGATGGTCTCTTTTTTAATATTCTGTATTTTTATTCGTTATTTCTAAAGTACATAACTTTTTCTTTTCTAATTTTGGATTTCTTTTATTTTTATTTTTAA[T/C]
TTTAATTAATCTCGTGTTTTTATTCTAAATGGACTATTTTCAATATTTCATATTTTTATTCTAAATTTTAGCTGTTCCTAAATTTGTATCCTACTAGAAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.30% | 7.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 62.80% | 37.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 78.80% | 21.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 56.20% | 43.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0815655246 | A -> G | LOC_Os08g25720.1 | upstream_gene_variant ; 3247.0bp to feature; MODIFIER | silent_mutation | Average:50.602; most accessible tissue: Zhenshan97 flower, score: 76.324 | N | N | N | N |
| vg0815655246 | A -> G | LOC_Os08g25710-LOC_Os08g25720 | intergenic_region ; MODIFIER | silent_mutation | Average:50.602; most accessible tissue: Zhenshan97 flower, score: 76.324 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0815655246 | 7.71E-08 | NA | Awn_length | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0815655246 | NA | 1.39E-06 | mr1078_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |