\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815646521:

Variant ID: vg0815646521 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 15646521
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTAGTACTCTCTCCGTCCTATAATATAAGGGATTTTTGAGTTTTTGGTTGAACTGTTTGACCACTCGTCTTATTCAAAAATTTGTACAAATATAAAAAA[C/T]
GAAAAGTTGCGCTTAAAGTACTTTAGATAATAAAGTAAGTCAAAAATAAATAAATAATAATTCCAAAAATTTTTTAATAAGACGAGTGGTCAAACAGTTC

Reverse complement sequence

GAACTGTTTGACCACTCGTCTTATTAAAAAATTTTTGGAATTATTATTTATTTATTTTTGACTTACTTTATTATCTAAAGTACTTTAAGCGCAACTTTTC[G/A]
TTTTTTATATTTGTACAAATTTTTGAATAAGACGAGTGGTCAAACAGTTCAACCAAAAACTCAAAAATCCCTTATATTATAGGACGGAGAGAGTACTAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.80% 38.30% 0.91% 0.00% NA
All Indica  2759 89.90% 8.70% 1.41% 0.00% NA
All Japonica  1512 7.10% 92.80% 0.13% 0.00% NA
Aus  269 71.00% 29.00% 0.00% 0.00% NA
Indica I  595 98.70% 0.30% 1.01% 0.00% NA
Indica II  465 91.80% 4.30% 3.87% 0.00% NA
Indica III  913 83.60% 16.00% 0.44% 0.00% NA
Indica Intermediate  786 89.30% 9.30% 1.40% 0.00% NA
Temperate Japonica  767 1.80% 98.00% 0.13% 0.00% NA
Tropical Japonica  504 15.70% 84.30% 0.00% 0.00% NA
Japonica Intermediate  241 5.80% 93.80% 0.41% 0.00% NA
VI/Aromatic  96 50.00% 50.00% 0.00% 0.00% NA
Intermediate  90 52.20% 45.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0815646521 C -> T LOC_Os08g25710.1 upstream_gene_variant ; 581.0bp to feature; MODIFIER silent_mutation Average:41.534; most accessible tissue: Callus, score: 82.234 N N N N
vg0815646521 C -> T LOC_Os08g25700.1 downstream_gene_variant ; 4521.0bp to feature; MODIFIER silent_mutation Average:41.534; most accessible tissue: Callus, score: 82.234 N N N N
vg0815646521 C -> T LOC_Os08g25710-LOC_Os08g25720 intergenic_region ; MODIFIER silent_mutation Average:41.534; most accessible tissue: Callus, score: 82.234 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0815646521 NA 2.57E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0815646521 9.48E-06 1.47E-08 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815646521 NA 9.69E-06 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815646521 NA 3.98E-18 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815646521 NA 8.46E-25 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815646521 NA 4.14E-07 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815646521 NA 2.70E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815646521 3.15E-07 4.73E-33 mr1238_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815646521 1.09E-07 5.19E-11 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815646521 6.39E-07 8.96E-30 mr1484_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815646521 6.28E-08 1.56E-11 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815646521 NA 2.75E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815646521 8.53E-06 1.96E-36 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815646521 5.62E-07 7.10E-11 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815646521 NA 1.34E-22 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815646521 NA 4.42E-07 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815646521 6.71E-06 2.35E-21 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815646521 4.52E-07 4.52E-07 mr1945_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251