\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815571010:

Variant ID: vg0815571010 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 15571010
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTCAAATTTGAATCGGATATATAAACTTTGGGCCTTTAAACTTTATATGCGTAAACTTGAGATGTATAAACTTTAGGTGCATAAATTTACTAAAATAT[A/G]
AAAGAAATATGGTGCAAAAAAAAAAACCAGGTAAAGGGAGGTAAAGGGAGGGGGAGACCCGATCCGATCGCCCCCGGCGGCCCCCGGCGATCAATCGCCC

Reverse complement sequence

GGGCGATTGATCGCCGGGGGCCGCCGGGGGCGATCGGATCGGGTCTCCCCCTCCCTTTACCTCCCTTTACCTGGTTTTTTTTTTTGCACCATATTTCTTT[T/C]
ATATTTTAGTAAATTTATGCACCTAAAGTTTATACATCTCAAGTTTACGCATATAAAGTTTAAAGGCCCAAAGTTTATATATCCGATTCAAATTTGAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.10% 24.30% 7.47% 1.10% NA
All Indica  2759 84.80% 1.80% 11.49% 1.85% NA
All Japonica  1512 31.20% 68.00% 0.86% 0.00% NA
Aus  269 77.00% 19.30% 3.72% 0.00% NA
Indica I  595 86.90% 0.00% 10.92% 2.18% NA
Indica II  465 78.90% 1.10% 17.85% 2.15% NA
Indica III  913 85.70% 3.60% 9.42% 1.31% NA
Indica Intermediate  786 85.90% 1.50% 10.56% 2.04% NA
Temperate Japonica  767 5.50% 93.90% 0.65% 0.00% NA
Tropical Japonica  504 71.20% 27.40% 1.39% 0.00% NA
Japonica Intermediate  241 29.00% 70.50% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 1.00% 2.08% 0.00% NA
Intermediate  90 65.60% 21.10% 12.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0815571010 A -> G LOC_Os08g25590.1 upstream_gene_variant ; 151.0bp to feature; MODIFIER silent_mutation Average:94.508; most accessible tissue: Minghui63 young leaf, score: 96.706 N N N N
vg0815571010 A -> G LOC_Os08g25600.1 upstream_gene_variant ; 4664.0bp to feature; MODIFIER silent_mutation Average:94.508; most accessible tissue: Minghui63 young leaf, score: 96.706 N N N N
vg0815571010 A -> G LOC_Os08g25590.2 upstream_gene_variant ; 142.0bp to feature; MODIFIER silent_mutation Average:94.508; most accessible tissue: Minghui63 young leaf, score: 96.706 N N N N
vg0815571010 A -> G LOC_Os08g25590.3 upstream_gene_variant ; 151.0bp to feature; MODIFIER silent_mutation Average:94.508; most accessible tissue: Minghui63 young leaf, score: 96.706 N N N N
vg0815571010 A -> G LOC_Os08g25580.1 downstream_gene_variant ; 4685.0bp to feature; MODIFIER silent_mutation Average:94.508; most accessible tissue: Minghui63 young leaf, score: 96.706 N N N N
vg0815571010 A -> G LOC_Os08g25580-LOC_Os08g25590 intergenic_region ; MODIFIER silent_mutation Average:94.508; most accessible tissue: Minghui63 young leaf, score: 96.706 N N N N
vg0815571010 A -> DEL N N silent_mutation Average:94.508; most accessible tissue: Minghui63 young leaf, score: 96.706 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0815571010 A G 0.01 0.0 -0.02 0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0815571010 NA 7.84E-40 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 8.68E-27 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 2.41E-27 mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 2.86E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 7.07E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 2.41E-22 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 7.86E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 1.76E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 1.25E-15 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 8.40E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 2.08E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 4.22E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 1.19E-22 mr1308_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 1.96E-21 mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 1.26E-23 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 2.27E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 1.28E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 2.77E-27 mr1584_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 9.51E-10 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 1.17E-06 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 8.49E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 4.74E-06 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 4.33E-12 mr1714_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 6.68E-13 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815571010 NA 2.25E-07 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251