| Variant ID: vg0815566806 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 15566806 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GGGGGCCGCCTGCAAATTTCCATGCCCTTCTCGCCGCCCATTTGTAGGCGGCCCCCCGCACAGTGTAAAATCGCCCTAGCGGAGGGCAGCAAGGGGGCCG[C/T]
CTGCAAATTTCCTTGACGGCCGTCGCCCGAGAGCGAACGGCCGTCTGCCACGTCACATTCGCCGCCCTCTGGGAAGGCACCCAAAGGGCGGCGGGCGAGT
ACTCGCCCGCCGCCCTTTGGGTGCCTTCCCAGAGGGCGGCGAATGTGACGTGGCAGACGGCCGTTCGCTCTCGGGCGACGGCCGTCAAGGAAATTTGCAG[G/A]
CGGCCCCCTTGCTGCCCTCCGCTAGGGCGATTTTACACTGTGCGGGGGGCCGCCTACAAATGGGCGGCGAGAAGGGCATGGAAATTTGCAGGCGGCCCCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.30% | 38.40% | 1.50% | 0.78% | NA |
| All Indica | 2759 | 81.90% | 14.40% | 2.39% | 1.30% | NA |
| All Japonica | 1512 | 19.80% | 80.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 57.20% | 42.00% | 0.37% | 0.37% | NA |
| Indica I | 595 | 95.00% | 0.80% | 3.03% | 1.18% | NA |
| Indica II | 465 | 82.40% | 10.50% | 3.44% | 3.66% | NA |
| Indica III | 913 | 76.00% | 22.90% | 0.99% | 0.11% | NA |
| Indica Intermediate | 786 | 78.80% | 16.90% | 2.93% | 1.40% | NA |
| Temperate Japonica | 767 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 47.00% | 52.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 13.70% | 85.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 50.00% | 50.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 51.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0815566806 | C -> T | LOC_Os08g25590.1 | upstream_gene_variant ; 4355.0bp to feature; MODIFIER | silent_mutation | Average:44.119; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0815566806 | C -> T | LOC_Os08g25590.2 | upstream_gene_variant ; 4346.0bp to feature; MODIFIER | silent_mutation | Average:44.119; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0815566806 | C -> T | LOC_Os08g25590.3 | upstream_gene_variant ; 4355.0bp to feature; MODIFIER | silent_mutation | Average:44.119; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0815566806 | C -> T | LOC_Os08g25580.1 | downstream_gene_variant ; 481.0bp to feature; MODIFIER | silent_mutation | Average:44.119; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0815566806 | C -> T | LOC_Os08g25580-LOC_Os08g25590 | intergenic_region ; MODIFIER | silent_mutation | Average:44.119; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0815566806 | C -> DEL | N | N | silent_mutation | Average:44.119; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0815566806 | NA | 3.54E-06 | mr1257 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815566806 | NA | 2.62E-06 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815566806 | NA | 4.66E-12 | mr1746 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815566806 | NA | 1.21E-08 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815566806 | NA | 1.87E-09 | mr1019_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815566806 | NA | 1.73E-11 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815566806 | NA | 3.59E-13 | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815566806 | NA | 1.80E-07 | mr1401_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815566806 | NA | 7.96E-14 | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815566806 | NA | 1.20E-06 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815566806 | NA | 7.99E-07 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |