Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815543792:

Variant ID: vg0815543792 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 15543792
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, A: 0.13, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


CTATTCGAATAGTTTTACTCTGGCCAGAGGTGTACAACTGTACCCACAAGACACGATTCCACACATGTCGCCATGCCCCGAAGTATCACCATGATACTGC[C/A]
AAGGGGGAAATCGTGACAAGACCCTCCACATAACCCTCCCCTAACCATCCACACCACGCTAAGGTTTCACCCCCACCCCTTAAAAGGCAGTGGGCGGTCC

Reverse complement sequence

GGACCGCCCACTGCCTTTTAAGGGGTGGGGGTGAAACCTTAGCGTGGTGTGGATGGTTAGGGGAGGGTTATGTGGAGGGTCTTGTCACGATTTCCCCCTT[G/T]
GCAGTATCATGGTGATACTTCGGGGCATGGCGACATGTGTGGAATCGTGTCTTGTGGGTACAGTTGTACACCTCTGGCCAGAGTAAAACTATTCGAATAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.20% 20.80% 39.00% 17.99% NA
All Indica  2759 1.80% 32.70% 52.12% 13.45% NA
All Japonica  1512 64.50% 1.10% 11.04% 23.41% NA
Aus  269 0.70% 19.70% 63.94% 15.61% NA
Indica I  595 1.20% 32.80% 51.26% 14.79% NA
Indica II  465 2.20% 35.70% 53.33% 8.82% NA
Indica III  913 1.40% 32.70% 52.03% 13.80% NA
Indica Intermediate  786 2.40% 30.70% 52.16% 14.76% NA
Temperate Japonica  767 86.70% 1.20% 9.39% 2.74% NA
Tropical Japonica  504 27.80% 1.40% 15.08% 55.75% NA
Japonica Intermediate  241 70.50% 0.00% 7.88% 21.58% NA
VI/Aromatic  96 2.10% 3.10% 29.17% 65.62% NA
Intermediate  90 24.40% 11.10% 42.22% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0815543792 C -> A LOC_Os08g25560.1 upstream_gene_variant ; 1596.0bp to feature; MODIFIER silent_mutation Average:17.616; most accessible tissue: Zhenshan97 root, score: 41.416 N N N N
vg0815543792 C -> A LOC_Os08g25550.1 downstream_gene_variant ; 4504.0bp to feature; MODIFIER silent_mutation Average:17.616; most accessible tissue: Zhenshan97 root, score: 41.416 N N N N
vg0815543792 C -> A LOC_Os08g25560-LOC_Os08g25570 intergenic_region ; MODIFIER silent_mutation Average:17.616; most accessible tissue: Zhenshan97 root, score: 41.416 N N N N
vg0815543792 C -> DEL N N silent_mutation Average:17.616; most accessible tissue: Zhenshan97 root, score: 41.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0815543792 NA 3.94E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815543792 NA 3.77E-14 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815543792 NA 1.19E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815543792 NA 9.58E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815543792 NA 4.79E-06 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815543792 NA 1.06E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815543792 NA 1.18E-27 mr1584_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815543792 NA 4.51E-08 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815543792 NA 1.92E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815543792 NA 2.52E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815543792 NA 6.44E-07 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815543792 NA 5.14E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815543792 NA 7.75E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251