\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815520975:

Variant ID: vg0815520975 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 15520975
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGACGCCCTTGTCATTCCCCTTTAAAAGAATGGAGACTTTTGGCGGTTCACCTCACGTGGAGGGAGCTCCTGACGGTACATTGATGGGATGGAGCATA[A/C]
CTGCCCCCACTTTGCTGAGCACAGGGTGGAACGTGGGGGCACCGCCGCTCGTCCGATCGGATGTGACCGGTCACAGACCGGTCACAATCCGGTCAATCGG

Reverse complement sequence

CCGATTGACCGGATTGTGACCGGTCTGTGACCGGTCACATCCGATCGGACGAGCGGCGGTGCCCCCACGTTCCACCCTGTGCTCAGCAAAGTGGGGGCAG[T/G]
TATGCTCCATCCCATCAATGTACCGTCAGGAGCTCCCTCCACGTGAGGTGAACCGCCAAAAGTCTCCATTCTTTTAAAGGGGAATGACAAGGGCGTCCCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.50% 0.20% 1.25% 76.09% NA
All Indica  2759 2.00% 0.10% 1.38% 96.48% NA
All Japonica  1512 64.60% 0.10% 0.66% 34.66% NA
Aus  269 0.70% 1.10% 3.35% 94.80% NA
Indica I  595 1.20% 0.00% 0.17% 98.66% NA
Indica II  465 4.50% 0.40% 0.43% 94.62% NA
Indica III  913 1.00% 0.00% 1.31% 97.70% NA
Indica Intermediate  786 2.40% 0.10% 2.93% 94.53% NA
Temperate Japonica  767 86.30% 0.10% 0.91% 12.65% NA
Tropical Japonica  504 28.20% 0.20% 0.60% 71.03% NA
Japonica Intermediate  241 71.40% 0.00% 0.00% 28.63% NA
VI/Aromatic  96 1.00% 0.00% 0.00% 98.96% NA
Intermediate  90 31.10% 0.00% 2.22% 66.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0815520975 A -> C LOC_Os08g25510.1 upstream_gene_variant ; 1006.0bp to feature; MODIFIER silent_mutation Average:24.585; most accessible tissue: Callus, score: 60.053 N N N N
vg0815520975 A -> C LOC_Os08g25500.1 downstream_gene_variant ; 3542.0bp to feature; MODIFIER silent_mutation Average:24.585; most accessible tissue: Callus, score: 60.053 N N N N
vg0815520975 A -> C LOC_Os08g25500-LOC_Os08g25510 intergenic_region ; MODIFIER silent_mutation Average:24.585; most accessible tissue: Callus, score: 60.053 N N N N
vg0815520975 A -> DEL N N silent_mutation Average:24.585; most accessible tissue: Callus, score: 60.053 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0815520975 NA 2.19E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975 NA 4.50E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975 NA 8.72E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975 NA 2.29E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975 NA 1.94E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975 NA 5.60E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975 NA 8.46E-14 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975 NA 3.78E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975 NA 6.43E-14 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975 3.90E-06 NA mr1742 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975 NA 6.80E-08 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975 NA 3.74E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975 NA 5.60E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975 NA 1.04E-10 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975 NA 4.74E-26 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975 NA 7.98E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975 NA 3.94E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251