Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815520975:

Variant ID: vg0815520975 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 15520975
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:

AGGGACGCCCTTGTCATTCCCCTTTAAAAGAATGGAGACTTTTGGCGGTTCACCTCACGTGGAGGGAGCTCCTGACGGTACATTGATGGGATGGAGCATA[A/C]
CTGCCCCCACTTTGCTGAGCACAGGGTGGAACGTGGGGGCACCGCCGCTCGTCCGATCGGATGTGACCGGTCACAGACCGGTCACAATCCGGTCAATCGG

Reverse complement sequence

CCGATTGACCGGATTGTGACCGGTCTGTGACCGGTCACATCCGATCGGACGAGCGGCGGTGCCCCCACGTTCCACCCTGTGCTCAGCAAAGTGGGGGCAG[T/G]
TATGCTCCATCCCATCAATGTACCGTCAGGAGCTCCCTCCACGTGAGGTGAACCGCCAAAAGTCTCCATTCTTTTAAAGGGGAATGACAAGGGCGTCCCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	22.50%	0.20%	1.25%	76.09%	NA
All Indica	2759	2.00%	0.10%	1.38%	96.48%	NA
All Japonica	1512	64.60%	0.10%	0.66%	34.66%	NA
Aus	269	0.70%	1.10%	3.35%	94.80%	NA
Indica I	595	1.20%	0.00%	0.17%	98.66%	NA
Indica II	465	4.50%	0.40%	0.43%	94.62%	NA
Indica III	913	1.00%	0.00%	1.31%	97.70%	NA
Indica Intermediate	786	2.40%	0.10%	2.93%	94.53%	NA
Temperate Japonica	767	86.30%	0.10%	0.91%	12.65%	NA
Tropical Japonica	504	28.20%	0.20%	0.60%	71.03%	NA
Japonica Intermediate	241	71.40%	0.00%	0.00%	28.63%	NA
VI/Aromatic	96	1.00%	0.00%	0.00%	98.96%	NA
Intermediate	90	31.10%	0.00%	2.22%	66.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0815520975	A -> C	LOC_Os08g25510.1	upstream_gene_variant ; 1006.0bp to feature; MODIFIER	silent_mutation	Average:24.585; most accessible tissue: Callus, score: 60.053	N	N	N	N
vg0815520975	A -> C	LOC_Os08g25500.1	downstream_gene_variant ; 3542.0bp to feature; MODIFIER	silent_mutation	Average:24.585; most accessible tissue: Callus, score: 60.053	N	N	N	N
vg0815520975	A -> C	LOC_Os08g25500-LOC_Os08g25510	intergenic_region ; MODIFIER	silent_mutation	Average:24.585; most accessible tissue: Callus, score: 60.053	N	N	N	N
vg0815520975	A -> DEL	N	N	silent_mutation	Average:24.585; most accessible tissue: Callus, score: 60.053	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0815520975	NA	2.19E-06	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975	NA	4.50E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975	NA	8.72E-06	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975	NA	2.29E-10	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975	NA	1.94E-06	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975	NA	5.60E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975	NA	8.46E-14	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975	NA	3.78E-06	mr1740	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975	NA	6.43E-14	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975	3.90E-06	NA	mr1742	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975	NA	6.80E-08	mr1742	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975	NA	3.74E-09	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975	NA	5.60E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975	NA	1.04E-10	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975	NA	4.74E-26	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975	NA	7.98E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520975	NA	3.94E-06	mr1780_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251