Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0815520189:

Variant ID: vg0815520189 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 15520189
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACCATTGTTTGGCTTATTTTGCTTATATGGCTGGTGAAGGATTTTCTATGGCTGGTGGTATTGGGATTTTTATTTTCTGTGTATGTTCACTAGAGAGTT[T/C]
CCATAATTAGCCACGACTGATGATCCAACTCCCTTGCGGGTCCCACTTGTTTGGCTGAAAAGCCTCAGCCCAAGCCTCAGCCAAACAAGCCATCCGATGA

Reverse complement sequence

TCATCGGATGGCTTGTTTGGCTGAGGCTTGGGCTGAGGCTTTTCAGCCAAACAAGTGGGACCCGCAAGGGAGTTGGATCATCAGTCGTGGCTAATTATGG[A/G]
AACTCTCTAGTGAACATACACAGAAAATAAAAATCCCAATACCACCAGCCATAGAAAATCCTTCACCAGCCATATAAGCAAAATAAGCCAAACAATGGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.60%	21.20%	0.17%	0.00%	NA
All Indica	2759	99.20%	0.50%	0.29%	0.00%	NA
All Japonica	1512	36.10%	63.90%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.20%	0.34%	0.00%	NA
Indica II	465	99.10%	0.60%	0.22%	0.00%	NA
Indica III	913	99.70%	0.20%	0.11%	0.00%	NA
Indica Intermediate	786	98.50%	1.00%	0.51%	0.00%	NA
Temperate Japonica	767	14.20%	85.80%	0.00%	0.00%	NA
Tropical Japonica	504	72.40%	27.60%	0.00%	0.00%	NA
Japonica Intermediate	241	29.90%	70.10%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0815520189	T -> C	LOC_Os08g25510.1	upstream_gene_variant ; 1792.0bp to feature; MODIFIER	silent_mutation	Average:64.947; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N
vg0815520189	T -> C	LOC_Os08g25500.1	downstream_gene_variant ; 2756.0bp to feature; MODIFIER	silent_mutation	Average:64.947; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N
vg0815520189	T -> C	LOC_Os08g25500-LOC_Os08g25510	intergenic_region ; MODIFIER	silent_mutation	Average:64.947; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0815520189	NA	7.09E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520189	NA	7.32E-13	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520189	NA	4.08E-12	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520189	NA	1.90E-07	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520189	NA	5.65E-12	mr1864	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520189	NA	2.81E-26	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815520189	NA	9.62E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251