Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815517828:

Variant ID: vg0815517828 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 15517828
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAAGTACATCATGATGCCGATTATTATTTAAGACCCGAAGCAACCTGGTAACGACAGTGAGGTGTACCTAAGACCATTCGTTGAAGATTTGAAAGTGCT[A/G]
TGGAGGAAAGAGGGTGTCCCCGTGTGGGATGAGGACAAGCAGGAGTATATTGAATCACTTTTTTGTTCTAAATTAGATATGCATATTAAATCTCTCGTTG

Reverse complement sequence

CAACGAGAGATTTAATATGCATATCTAATTTAGAACAAAAAAGTGATTCAATATACTCCTGCTTGTCCTCATCCCACACGGGGACACCCTCTTTCCTCCA[T/C]
AGCACTTTCAAATCTTCAACGAATGGTCTTAGGTACACCTCACTGTCGTTACCAGGTTGCTTCGGGTCTTAAATAATAATCGGCATCATGATGTACTTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.40%	24.30%	0.15%	0.17%	NA
All Indica	2759	98.30%	1.30%	0.25%	0.18%	NA
All Japonica	1512	32.40%	67.50%	0.00%	0.07%	NA
Aus	269	93.70%	6.30%	0.00%	0.00%	NA
Indica I	595	99.70%	0.00%	0.00%	0.34%	NA
Indica II	465	98.70%	0.60%	0.65%	0.00%	NA
Indica III	913	99.10%	0.70%	0.11%	0.11%	NA
Indica Intermediate	786	95.90%	3.40%	0.38%	0.25%	NA
Temperate Japonica	767	14.20%	85.70%	0.00%	0.13%	NA
Tropical Japonica	504	61.90%	38.10%	0.00%	0.00%	NA
Japonica Intermediate	241	28.60%	71.40%	0.00%	0.00%	NA
VI/Aromatic	96	55.20%	44.80%	0.00%	0.00%	NA
Intermediate	90	62.20%	35.60%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0815517828	A -> G	LOC_Os08g25510.1	upstream_gene_variant ; 4153.0bp to feature; MODIFIER	silent_mutation	Average:55.242; most accessible tissue: Minghui63 young leaf, score: 67.374	N	N	N	N
vg0815517828	A -> G	LOC_Os08g25500.1	downstream_gene_variant ; 395.0bp to feature; MODIFIER	silent_mutation	Average:55.242; most accessible tissue: Minghui63 young leaf, score: 67.374	N	N	N	N
vg0815517828	A -> G	LOC_Os08g25500-LOC_Os08g25510	intergenic_region ; MODIFIER	silent_mutation	Average:55.242; most accessible tissue: Minghui63 young leaf, score: 67.374	N	N	N	N
vg0815517828	A -> DEL	N	N	silent_mutation	Average:55.242; most accessible tissue: Minghui63 young leaf, score: 67.374	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0815517828	NA	9.39E-06	mr1397	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815517828	NA	1.40E-07	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815517828	NA	2.72E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815517828	NA	5.90E-12	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815517828	NA	1.60E-09	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815517828	3.68E-06	8.24E-28	mr1653_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815517828	NA	1.66E-08	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251