Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815403093:

Variant ID: vg0815403093 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 15403093
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGCATAAATGCCAATTTTAGTTCACAACATGTTTCGCAACGGAATTTTATAACAATAGTATAGAGTAAGTAAAACTTGTAATGTGAATGAATAAATAA[T/C]
ACACATCTACCCCTCAAGGTAGATCATCACCACTCTCCATCATCTCATCACCATTCACCGAACTTTACCCAAGTTCACAAACAAAACATTCCAACCATTT

Reverse complement sequence

AAATGGTTGGAATGTTTTGTTTGTGAACTTGGGTAAAGTTCGGTGAATGGTGATGAGATGATGGAGAGTGGTGATGATCTACCTTGAGGGGTAGATGTGT[A/G]
TTATTTATTCATTCACATTACAAGTTTTACTTACTCTATACTATTGTTATAAAATTCCGTTGCGAAACATGTTGTGAACTAAAATTGGCATTTATGCAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.30%	7.00%	8.57%	13.10%	NA
All Indica	2759	90.90%	2.00%	6.71%	0.43%	NA
All Japonica	1512	28.80%	18.10%	14.22%	38.89%	NA
Aus	269	98.50%	0.40%	0.74%	0.37%	NA
Indica I	595	99.50%	0.20%	0.34%	0.00%	NA
Indica II	465	94.60%	1.90%	2.37%	1.08%	NA
Indica III	913	83.40%	2.50%	13.91%	0.22%	NA
Indica Intermediate	786	90.80%	2.80%	5.73%	0.64%	NA
Temperate Japonica	767	6.30%	28.30%	19.17%	46.28%	NA
Tropical Japonica	504	63.50%	5.00%	5.95%	25.60%	NA
Japonica Intermediate	241	28.20%	12.90%	15.77%	43.15%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	73.30%	4.40%	3.33%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0815403093	T -> C	LOC_Os08g25310.1	downstream_gene_variant ; 4441.0bp to feature; MODIFIER	silent_mutation	Average:34.829; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0815403093	T -> C	LOC_Os08g25330.1	downstream_gene_variant ; 4718.0bp to feature; MODIFIER	silent_mutation	Average:34.829; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0815403093	T -> C	LOC_Os08g25310-LOC_Os08g25330	intergenic_region ; MODIFIER	silent_mutation	Average:34.829; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0815403093	T -> DEL	N	N	silent_mutation	Average:34.829; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0815403093	NA	3.92E-07	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815403093	NA	2.46E-08	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815403093	NA	5.23E-12	mr1938	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815403093	1.05E-06	6.97E-10	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815403093	2.80E-07	8.70E-11	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815403093	NA	6.54E-09	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815403093	NA	2.40E-06	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251