\
| Variant ID: vg0815339015 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 15339015 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.02, others allele: 0.00, population size: 241. )
GGACCTGTAAGCATCTTCCTGCTTTGATTGCTCTAGTTACTATTGTCCTGTTAGGTAATAAAGTGCACGTTAGTATTATGATAAGTTGTAGTAACGTTAG[T/C]
GAGAGAAATAAAATTCAGTTTACCTTCGTTTCACAAGTCATGTTTACATTTTGATTTATATAGGACTCTTCGTTATGATTTGATACATGCTCCCTGGGAT
ATCCCAGGGAGCATGTATCAAATCATAACGAAGAGTCCTATATAAATCAAAATGTAAACATGACTTGTGAAACGAAGGTAAACTGAATTTTATTTCTCTC[A/G]
CTAACGTTACTACAACTTATCATAATACTAACGTGCACTTTATTACCTAACAGGACAATAGTAACTAGAGCAATCAAAGCAGGAAGATGCTTACAGGTCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.50% | 8.60% | 0.25% | 0.57% | NA |
| All Indica | 2759 | 99.50% | 0.10% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 75.70% | 22.50% | 0.00% | 1.79% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 0.20% | 1.94% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 87.70% | 9.50% | 0.00% | 2.74% | NA |
| Tropical Japonica | 504 | 52.60% | 46.60% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 85.90% | 13.30% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 45.80% | 54.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 14.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0815339015 | T -> C | LOC_Os08g25240.1 | upstream_gene_variant ; 3638.0bp to feature; MODIFIER | silent_mutation | Average:24.413; most accessible tissue: Callus, score: 40.15 | N | N | N | N |
| vg0815339015 | T -> C | LOC_Os08g25250.1 | intron_variant ; MODIFIER | silent_mutation | Average:24.413; most accessible tissue: Callus, score: 40.15 | N | N | N | N |
| vg0815339015 | T -> DEL | N | N | silent_mutation | Average:24.413; most accessible tissue: Callus, score: 40.15 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0815339015 | NA | 9.04E-06 | mr1041 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815339015 | NA | 1.78E-06 | mr1092 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815339015 | NA | 1.23E-06 | mr1184 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815339015 | NA | 9.00E-06 | mr1616 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815339015 | NA | 3.18E-07 | mr1680 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815339015 | NA | 9.38E-07 | mr1709 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815339015 | NA | 2.15E-09 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815339015 | NA | 3.74E-07 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815339015 | NA | 2.09E-08 | mr1851 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815339015 | NA | 1.92E-06 | mr1851 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815339015 | 4.66E-06 | 1.55E-14 | mr1864 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815339015 | NA | 1.20E-09 | mr1864 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815339015 | NA | 7.08E-06 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815339015 | NA | 7.06E-07 | mr1671_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815339015 | NA | 3.61E-08 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |