\
| Variant ID: vg0815289622 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr08 | Position: 15289622 |
| Reference Allele: TA | Alternative Allele: CA,TATCCAAAATTCCAA,T |
| Primary Allele: TA | Secondary Allele: CA |
Inferred Ancestral Allele: Not determined.
CCAATTCTAAATTTATTTTTTTTGATAGAGAGAGTATGCAGGATTCTATTGTATCATAGTCCTAGGCTGGGTTCGTTGTTGTGTGTTGGGAATACATTTC[TA/CA,TATCCAAAATTCCAA,T]
GCGCACGAAAAATTGAGCGGTCCATTAGCATGTGATTAATTCAGTATTAGGTAATTTTATTTTCAAAAATGGATCAATATGATTTTTTAAGCAACTTTCA
TGAAAGTTGCTTAAAAAATCATATTGATCCATTTTTGAAAATAAAATTACCTAATACTGAATTAATCACATGCTAATGGACCGCTCAATTTTTCGTGCGC[TA/TG,TTGGAATTTTGGATA,A]
GAAATGTATTCCCAACACACAACAACGAACCCAGCCTAGGACTATGATACAATAGAATCCTGCATACTCTCTCTATCAAAAAAAATAAATTTAGAATTGG
| Populations | Population Size | Frequency of TA(primary allele) | Frequency of CA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.40% | 3.80% | 11.19% | 8.55% | TATCCAAAATTCCAA: 1.38%; T: 0.72% |
| All Indica | 2759 | 64.20% | 0.70% | 17.87% | 14.03% | TATCCAAAATTCCAA: 2.07%; T: 1.12% |
| All Japonica | 1512 | 92.30% | 7.10% | 0.26% | 0.20% | TATCCAAAATTCCAA: 0.07% |
| Aus | 269 | 83.60% | 0.00% | 8.92% | 4.46% | TATCCAAAATTCCAA: 1.86%; T: 1.12% |
| Indica I | 595 | 62.40% | 0.00% | 25.71% | 9.24% | T: 1.34%; TATCCAAAATTCCAA: 1.34% |
| Indica II | 465 | 60.90% | 3.20% | 20.22% | 12.90% | TATCCAAAATTCCAA: 1.94%; T: 0.86% |
| Indica III | 913 | 67.00% | 0.10% | 10.08% | 17.96% | TATCCAAAATTCCAA: 3.40%; T: 1.42% |
| Indica Intermediate | 786 | 64.20% | 0.50% | 19.59% | 13.74% | TATCCAAAATTCCAA: 1.15%; T: 0.76% |
| Temperate Japonica | 767 | 91.30% | 8.00% | 0.39% | 0.26% | TATCCAAAATTCCAA: 0.13% |
| Tropical Japonica | 504 | 91.30% | 8.30% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 60.40% | 38.50% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 73.30% | 14.40% | 8.89% | 1.11% | TATCCAAAATTCCAA: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0815289622 | TA -> T | LOC_Os08g25160-LOC_Os08g25180 | intergenic_region ; MODIFIER | silent_mutation | Average:55.983; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg0815289622 | TA -> TATCCAAAATTCCAA | LOC_Os08g25160-LOC_Os08g25180 | intergenic_region ; MODIFIER | silent_mutation | Average:55.983; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg0815289622 | TA -> DEL | N | N | silent_mutation | Average:55.983; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg0815289622 | TA -> CA | LOC_Os08g25160-LOC_Os08g25180 | intergenic_region ; MODIFIER | silent_mutation | Average:55.983; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0815289622 | NA | 4.78E-06 | mr1155_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815289622 | 5.71E-06 | NA | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815289622 | 7.15E-07 | NA | mr1771_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815289622 | 3.89E-06 | NA | mr1784_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815289622 | 4.00E-06 | NA | mr1862_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |