Variant ID: vg0815283554 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 15283554 |
Reference Allele: G | Alternative Allele: A,T |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 209. )
GTTAAATATAACTTCACATCTTAATGCTTTCTAGTCGAATTTCTCGTTGGTTCCATTCGACTATAAATAATTAATATACTAAGGAAATGACCATCATAAT[G/A,T]
ATGTTGACATGAAATCATAAATACTTTCTAGTTAAATTTCCATTCAACTAGAAATAAATTAAGTGGCTTAAGGAAATAATAATCTTAATAAATATTGACA
TGTCAATATTTATTAAGATTATTATTTCCTTAAGCCACTTAATTTATTTCTAGTTGAATGGAAATTTAACTAGAAAGTATTTATGATTTCATGTCAACAT[C/T,A]
ATTATGATGGTCATTTCCTTAGTATATTAATTATTTATAGTCGAATGGAACCAACGAGAAATTCGACTAGAAAGCATTAAGATGTGAAGTTATATTTAAC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.90% | 2.10% | 0.99% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 93.00% | 3.90% | 3.11% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 92.20% | 2.00% | 5.87% | 0.00% | NA |
Tropical Japonica | 504 | 91.90% | 8.10% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 97.90% | 1.20% | 0.83% | 0.00% | NA |
VI/Aromatic | 96 | 65.60% | 34.40% | 0.00% | 0.00% | NA |
Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0815283554 | G -> T | LOC_Os08g25160.1 | upstream_gene_variant ; 1067.0bp to feature; MODIFIER | N | Average:26.34; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 | N | N | N | N |
vg0815283554 | G -> T | LOC_Os08g25160-LOC_Os08g25180 | intergenic_region ; MODIFIER | N | Average:26.34; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 | N | N | N | N |
vg0815283554 | G -> A | LOC_Os08g25160.1 | upstream_gene_variant ; 1067.0bp to feature; MODIFIER | silent_mutation | Average:26.34; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 | N | N | N | N |
vg0815283554 | G -> A | LOC_Os08g25160-LOC_Os08g25180 | intergenic_region ; MODIFIER | silent_mutation | Average:26.34; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0815283554 | NA | 7.20E-06 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815283554 | NA | 5.71E-06 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815283554 | NA | 6.50E-06 | mr1045_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815283554 | 5.90E-07 | 5.17E-07 | mr1255_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815283554 | NA | 9.35E-06 | mr1405_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0815283554 | NA | 8.67E-06 | mr1458_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |