\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815283554:

Variant ID: vg0815283554 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 15283554
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


GTTAAATATAACTTCACATCTTAATGCTTTCTAGTCGAATTTCTCGTTGGTTCCATTCGACTATAAATAATTAATATACTAAGGAAATGACCATCATAAT[G/A,T]
ATGTTGACATGAAATCATAAATACTTTCTAGTTAAATTTCCATTCAACTAGAAATAAATTAAGTGGCTTAAGGAAATAATAATCTTAATAAATATTGACA

Reverse complement sequence

TGTCAATATTTATTAAGATTATTATTTCCTTAAGCCACTTAATTTATTTCTAGTTGAATGGAAATTTAACTAGAAAGTATTTATGATTTCATGTCAACAT[C/T,A]
ATTATGATGGTCATTTCCTTAGTATATTAATTATTTATAGTCGAATGGAACCAACGAGAAATTCGACTAGAAAGCATTAAGATGTGAAGTTATATTTAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.90% 2.10% 0.99% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 93.00% 3.90% 3.11% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 92.20% 2.00% 5.87% 0.00% NA
Tropical Japonica  504 91.90% 8.10% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 1.20% 0.83% 0.00% NA
VI/Aromatic  96 65.60% 34.40% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0815283554 G -> T LOC_Os08g25160.1 upstream_gene_variant ; 1067.0bp to feature; MODIFIER N Average:26.34; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 N N N N
vg0815283554 G -> T LOC_Os08g25160-LOC_Os08g25180 intergenic_region ; MODIFIER N Average:26.34; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 N N N N
vg0815283554 G -> A LOC_Os08g25160.1 upstream_gene_variant ; 1067.0bp to feature; MODIFIER silent_mutation Average:26.34; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 N N N N
vg0815283554 G -> A LOC_Os08g25160-LOC_Os08g25180 intergenic_region ; MODIFIER silent_mutation Average:26.34; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0815283554 NA 7.20E-06 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815283554 NA 5.71E-06 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815283554 NA 6.50E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815283554 5.90E-07 5.17E-07 mr1255_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815283554 NA 9.35E-06 mr1405_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815283554 NA 8.67E-06 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251