\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815185480:

Variant ID: vg0815185480 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 15185480
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCGCGTCGATGTAGAGTAAGTAGTCGATCGCACCGGCTCGACCTTCTCCTCCTCGTGCGTTCTCCTCGCCGTACTCCCACGCCGATCAGCACCGCAAAC[C/T]
AGCGGCGCCTCTACCGGTATCCACACGTACAGGAACGGAACGCCACGCGCAGATGTGCTAGCACTCACGCACGGCTAGGGTTTTGCTCGGGGAGGCAAGT

Reverse complement sequence

ACTTGCCTCCCCGAGCAAAACCCTAGCCGTGCGTGAGTGCTAGCACATCTGCGCGTGGCGTTCCGTTCCTGTACGTGTGGATACCGGTAGAGGCGCCGCT[G/A]
GTTTGCGGTGCTGATCGGCGTGGGAGTACGGCGAGGAGAACGCACGAGGAGGAGAAGGTCGAGCCGGTGCGATCGACTACTTACTCTACATCGACGCGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 7.30% 0.04% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 81.80% 18.10% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 53.40% 46.40% 0.20% 0.00% NA
Japonica Intermediate  241 87.60% 12.40% 0.00% 0.00% NA
VI/Aromatic  96 45.80% 54.20% 0.00% 0.00% NA
Intermediate  90 84.40% 14.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0815185480 C -> T LOC_Os08g25020.1 downstream_gene_variant ; 3784.0bp to feature; MODIFIER silent_mutation Average:23.332; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0815185480 C -> T LOC_Os08g25010-LOC_Os08g25020 intergenic_region ; MODIFIER silent_mutation Average:23.332; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0815185480 NA 4.11E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815185480 4.92E-06 NA mr1363_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815185480 NA 7.18E-08 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815185480 NA 1.86E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251