\
| Variant ID: vg0815176909 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 15176909 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACCTGTACTGGTTGGATGTGGCATTGTGCTGACGAGTGGACGTCGTGCTGGCCGGCCGGGCAGCAGATGAGATCGCTGAAGGCTGCAAGCAACTCGTCGT[A/C]
CCGTCCTGCAGGACCTCCGCGGCTCTGACGTCGTTGCTGCCGCCGCCGCTCTCGCCTCGACTCTTTCTGTATCGCGCCTTAATGATCACGGTCTAGCGCT
AGCGCTAGACCGTGATCATTAAGGCGCGATACAGAAAGAGTCGAGGCGAGAGCGGCGGCGGCAGCAACGACGTCAGAGCCGCGGAGGTCCTGCAGGACGG[T/G]
ACGACGAGTTGCTTGCAGCCTTCAGCGATCTCATCTGCTGCCCGGCCGGCCAGCACGACGTCCACTCGTCAGCACAATGCCACATCCAACCAGTACAGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.20% | 23.80% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 28.00% | 72.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 6.50% | 93.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 62.10% | 37.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 25.30% | 74.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0815176909 | A -> C | LOC_Os08g25010-LOC_Os08g25020 | intergenic_region ; MODIFIER | silent_mutation | Average:70.639; most accessible tissue: Zhenshan97 young leaf, score: 88.759 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0815176909 | NA | 2.53E-30 | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815176909 | NA | 3.97E-39 | mr1235 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815176909 | NA | 2.33E-26 | mr1423 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815176909 | NA | 2.92E-44 | mr1563 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815176909 | 1.20E-06 | 9.59E-21 | mr1768 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815176909 | NA | 5.36E-35 | mr1784 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815176909 | NA | 6.73E-10 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815176909 | NA | 2.83E-51 | mr1261_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815176909 | NA | 4.59E-06 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815176909 | NA | 1.13E-06 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0815176909 | NA | 1.59E-25 | mr1653_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |