\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815150136:

Variant ID: vg0815150136 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 15150136
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACGACCGTGTACTCAGTCATGTTAGACTTCACAACCCTGAACTGCCTTTGCATCTAGAATGACCATGACTTCACTGCGTCTTGCAACCCAGTTTTGTCA[T/C]
GGAACATTGCACCCAGATTGATTTGGCCATCCCCGTAGAACCATATTGAATCATGACAAGAGTTTTCTGCAATATAACCAGGGTCTTCAAGGTTCCACGA

Reverse complement sequence

TCGTGGAACCTTGAAGACCCTGGTTATATTGCAGAAAACTCTTGTCATGATTCAATATGGTTCTACGGGGATGGCCAAATCAATCTGGGTGCAATGTTCC[A/G]
TGACAAAACTGGGTTGCAAGACGCAGTGAAGTCATGGTCATTCTAGATGCAAAGGCAGTTCAGGGTTGTGAAGTCTAACATGACTGAGTACACGGTCGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.80% 31.70% 18.87% 5.63% NA
All Indica  2759 54.80% 7.80% 28.16% 9.28% NA
All Japonica  1512 22.50% 73.30% 4.03% 0.13% NA
Aus  269 39.40% 45.70% 12.64% 2.23% NA
Indica I  595 52.90% 1.00% 38.49% 7.56% NA
Indica II  465 62.20% 5.60% 26.02% 6.24% NA
Indica III  913 53.20% 8.20% 25.30% 13.25% NA
Indica Intermediate  786 53.70% 13.60% 24.94% 7.76% NA
Temperate Japonica  767 3.40% 89.20% 7.17% 0.26% NA
Tropical Japonica  504 55.80% 43.70% 0.60% 0.00% NA
Japonica Intermediate  241 13.70% 85.10% 1.24% 0.00% NA
VI/Aromatic  96 72.90% 18.80% 8.33% 0.00% NA
Intermediate  90 44.40% 40.00% 13.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0815150136 T -> C LOC_Os08g24980.1 missense_variant ; p.His252Arg; MODERATE nonsynonymous_codon ; H252R Average:25.14; most accessible tissue: Zhenshan97 root, score: 32.766 benign -0.109 TOLERATED 1.00
vg0815150136 T -> DEL LOC_Os08g24980.1 N frameshift_variant Average:25.14; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0815150136 NA 1.03E-08 mr1134 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815150136 4.48E-06 1.28E-07 mr1135 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815150136 NA 7.60E-06 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815150136 NA 1.85E-06 mr1504 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815150136 4.42E-07 6.38E-08 mr1672 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815150136 NA 2.15E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815150136 NA 2.61E-06 mr1838 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815150136 NA 1.69E-06 mr1040_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815150136 NA 3.56E-06 mr1070_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815150136 NA 7.18E-06 mr1085_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815150136 NA 8.21E-06 mr1088_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815150136 NA 4.88E-06 mr1134_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815150136 2.71E-06 2.71E-06 mr1145_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815150136 1.01E-06 2.52E-09 mr1155_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815150136 1.82E-07 6.43E-07 mr1227_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815150136 NA 1.73E-06 mr1362_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815150136 NA 7.68E-06 mr1405_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815150136 NA 7.59E-06 mr1437_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815150136 NA 1.41E-06 mr1672_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251