Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0814654076:

Variant ID: vg0814654076 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 14654076
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGAAGATAATTTGTTCATGTGCTGACTGTAAGAATGAAATAGCCTGGGACTTTGATGATGCTTTTAAAGTGAAGGAGCACTTAGTAACTCGTGGATTTAT[G/A]
GACAAGTAAGAAATATGGACACGTCATGGCGAAGAACAAGTGGACGGGCCTGAAAATGTAGTACCGACACAAGTTGAAGACATGGTGCATGACGATGGTT

Reverse complement sequence

AACCATCGTCATGCACCATGTCTTCAACTTGTGTCGGTACTACATTTTCAGGCCCGTCCACTTGTTCTTCGCCATGACGTGTCCATATTTCTTACTTGTC[C/T]
ATAAATCCACGAGTTACTAAGTGCTCCTTCACTTTAAAAGCATCATCAAAGTCCCAGGCTATTTCATTCTTACAGTCAGCACATGAACAAATTATCTTCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.60%	1.40%	1.97%	25.07%	NA
All Indica	2759	62.30%	0.10%	3.04%	34.58%	NA
All Japonica	1512	92.90%	4.20%	0.20%	2.78%	NA
Aus	269	33.80%	0.00%	1.86%	64.31%	NA
Indica I	595	50.40%	0.30%	4.87%	44.37%	NA
Indica II	465	60.90%	0.00%	2.37%	36.77%	NA
Indica III	913	69.40%	0.00%	1.97%	28.59%	NA
Indica Intermediate	786	63.90%	0.00%	3.31%	32.82%	NA
Temperate Japonica	767	88.50%	8.00%	0.26%	3.26%	NA
Tropical Japonica	504	98.40%	0.00%	0.00%	1.59%	NA
Japonica Intermediate	241	95.00%	0.80%	0.41%	3.73%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	83.30%	0.00%	1.11%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0814654076	G -> A	LOC_Os08g24270.1	upstream_gene_variant ; 1875.0bp to feature; MODIFIER	silent_mutation	Average:7.25; most accessible tissue: Callus, score: 28.415	N	N	N	N
vg0814654076	G -> A	LOC_Os08g24280.1	upstream_gene_variant ; 82.0bp to feature; MODIFIER	silent_mutation	Average:7.25; most accessible tissue: Callus, score: 28.415	N	N	N	N
vg0814654076	G -> A	LOC_Os08g24270-LOC_Os08g24280	intergenic_region ; MODIFIER	silent_mutation	Average:7.25; most accessible tissue: Callus, score: 28.415	N	N	N	N
vg0814654076	G -> DEL	N	N	silent_mutation	Average:7.25; most accessible tissue: Callus, score: 28.415	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0814654076	NA	4.94E-08	mr1028	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814654076	4.40E-06	4.40E-06	mr1369	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814654076	NA	3.44E-07	mr1453	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814654076	NA	8.36E-08	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814654076	NA	4.13E-07	mr1652	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814654076	4.56E-08	2.69E-11	mr1697	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814654076	NA	8.60E-06	mr1458_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251