Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0814579002:

Variant ID: vg0814579002 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 14579002
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTCACGTCTCTAATAAGATGAAACAGAAAATAAGCTCAATAAGCTCCCATACAATAATTTAATGACCATACAATACTAGAAAGTCTTATAGTATGAAA[C/T]
GGAGGGAGTACCAATTTTTTACGAATTTAAAATATTTTTTTGTTATTTACAACATTCACAAAATATTCAAATAATGCTATTTTACGATTTAGAATAATGA

Reverse complement sequence

TCATTATTCTAAATCGTAAAATAGCATTATTTGAATATTTTGTGAATGTTGTAAATAACAAAAAAATATTTTAAATTCGTAAAAAATTGGTACTCCCTCC[G/A]
TTTCATACTATAAGACTTTCTAGTATTGTATGGTCATTAAATTATTGTATGGGAGCTTATTGAGCTTATTTTCTGTTTCATCTTATTAGAGACGTGAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.10%	9.90%	0.49%	50.51%	NA
All Indica	2759	12.40%	5.80%	0.83%	81.01%	NA
All Japonica	1512	89.50%	4.70%	0.00%	5.82%	NA
Aus	269	2.20%	84.00%	0.00%	13.75%	NA
Indica I	595	4.40%	0.20%	1.01%	94.45%	NA
Indica II	465	10.30%	3.90%	0.86%	84.95%	NA
Indica III	913	18.90%	6.50%	0.88%	73.71%	NA
Indica Intermediate	786	12.10%	10.30%	0.64%	76.97%	NA
Temperate Japonica	767	87.10%	2.90%	0.00%	10.04%	NA
Tropical Japonica	504	94.00%	5.20%	0.00%	0.79%	NA
Japonica Intermediate	241	87.60%	9.50%	0.00%	2.90%	NA
VI/Aromatic	96	95.80%	2.10%	0.00%	2.08%	NA
Intermediate	90	61.10%	11.10%	0.00%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0814579002	C -> T	LOC_Os08g24130.1	upstream_gene_variant ; 4736.0bp to feature; MODIFIER	silent_mutation	Average:9.15; most accessible tissue: Callus, score: 49.313	N	N	N	N
vg0814579002	C -> T	LOC_Os08g24140.1	downstream_gene_variant ; 1094.0bp to feature; MODIFIER	silent_mutation	Average:9.15; most accessible tissue: Callus, score: 49.313	N	N	N	N
vg0814579002	C -> T	LOC_Os08g24150.1	downstream_gene_variant ; 3678.0bp to feature; MODIFIER	silent_mutation	Average:9.15; most accessible tissue: Callus, score: 49.313	N	N	N	N
vg0814579002	C -> T	LOC_Os08g24130-LOC_Os08g24140	intergenic_region ; MODIFIER	silent_mutation	Average:9.15; most accessible tissue: Callus, score: 49.313	N	N	N	N
vg0814579002	C -> DEL	N	N	silent_mutation	Average:9.15; most accessible tissue: Callus, score: 49.313	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0814579002	NA	2.44E-08	mr1134	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814579002	NA	7.02E-08	mr1135	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814579002	NA	3.81E-06	mr1504	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814579002	NA	3.51E-08	mr1134_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814579002	NA	4.48E-15	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814579002	NA	5.23E-14	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814579002	2.61E-07	2.61E-07	mr1670_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814579002	NA	5.23E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814579002	NA	5.52E-07	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814579002	NA	3.43E-07	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251