| Variant ID: vg0814579002 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 14579002 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTTCACGTCTCTAATAAGATGAAACAGAAAATAAGCTCAATAAGCTCCCATACAATAATTTAATGACCATACAATACTAGAAAGTCTTATAGTATGAAA[C/T]
GGAGGGAGTACCAATTTTTTACGAATTTAAAATATTTTTTTGTTATTTACAACATTCACAAAATATTCAAATAATGCTATTTTACGATTTAGAATAATGA
TCATTATTCTAAATCGTAAAATAGCATTATTTGAATATTTTGTGAATGTTGTAAATAACAAAAAAATATTTTAAATTCGTAAAAAATTGGTACTCCCTCC[G/A]
TTTCATACTATAAGACTTTCTAGTATTGTATGGTCATTAAATTATTGTATGGGAGCTTATTGAGCTTATTTTCTGTTTCATCTTATTAGAGACGTGAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.10% | 9.90% | 0.49% | 50.51% | NA |
| All Indica | 2759 | 12.40% | 5.80% | 0.83% | 81.01% | NA |
| All Japonica | 1512 | 89.50% | 4.70% | 0.00% | 5.82% | NA |
| Aus | 269 | 2.20% | 84.00% | 0.00% | 13.75% | NA |
| Indica I | 595 | 4.40% | 0.20% | 1.01% | 94.45% | NA |
| Indica II | 465 | 10.30% | 3.90% | 0.86% | 84.95% | NA |
| Indica III | 913 | 18.90% | 6.50% | 0.88% | 73.71% | NA |
| Indica Intermediate | 786 | 12.10% | 10.30% | 0.64% | 76.97% | NA |
| Temperate Japonica | 767 | 87.10% | 2.90% | 0.00% | 10.04% | NA |
| Tropical Japonica | 504 | 94.00% | 5.20% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 87.60% | 9.50% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 95.80% | 2.10% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 61.10% | 11.10% | 0.00% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0814579002 | C -> T | LOC_Os08g24130.1 | upstream_gene_variant ; 4736.0bp to feature; MODIFIER | silent_mutation | Average:9.15; most accessible tissue: Callus, score: 49.313 | N | N | N | N |
| vg0814579002 | C -> T | LOC_Os08g24140.1 | downstream_gene_variant ; 1094.0bp to feature; MODIFIER | silent_mutation | Average:9.15; most accessible tissue: Callus, score: 49.313 | N | N | N | N |
| vg0814579002 | C -> T | LOC_Os08g24150.1 | downstream_gene_variant ; 3678.0bp to feature; MODIFIER | silent_mutation | Average:9.15; most accessible tissue: Callus, score: 49.313 | N | N | N | N |
| vg0814579002 | C -> T | LOC_Os08g24130-LOC_Os08g24140 | intergenic_region ; MODIFIER | silent_mutation | Average:9.15; most accessible tissue: Callus, score: 49.313 | N | N | N | N |
| vg0814579002 | C -> DEL | N | N | silent_mutation | Average:9.15; most accessible tissue: Callus, score: 49.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0814579002 | NA | 2.44E-08 | mr1134 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814579002 | NA | 7.02E-08 | mr1135 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814579002 | NA | 3.81E-06 | mr1504 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814579002 | NA | 3.51E-08 | mr1134_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814579002 | NA | 4.48E-15 | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814579002 | NA | 5.23E-14 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814579002 | 2.61E-07 | 2.61E-07 | mr1670_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814579002 | NA | 5.23E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814579002 | NA | 5.52E-07 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814579002 | NA | 3.43E-07 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |