\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0814576026:

Variant ID: vg0814576026 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 14576026
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


AACCGAAAATTTGCCAAGGAATCTTACTAAATTTGGCGTTAACACAACATCAACACTCTGCTACAACAGGGTCCTTTCAACCTAGTAACCCACCTTGATG[C/T]
GGATGCGTGGTTATATAAGTTGAAACGACTATCCCCAAGTCTAATATATTTCATTTTGGGAGTTTTTGGGTTAATCATGATTGGTTTCTAGAGCAGGTCA

Reverse complement sequence

TGACCTGCTCTAGAAACCAATCATGATTAACCCAAAAACTCCCAAAATGAAATATATTAGACTTGGGGATAGTCGTTTCAACTTATATAACCACGCATCC[G/A]
CATCAAGGTGGGTTACTAGGTTGAAAGGACCCTGTTGTAGCAGAGTGTTGATGTTGTGTTAACGCCAAATTTAGTAAGATTCCTTGGCAAATTTTCGGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.70% 13.30% 1.59% 47.36% NA
All Indica  2759 19.00% 0.30% 2.50% 78.22% NA
All Japonica  1512 58.30% 40.20% 0.13% 1.39% NA
Aus  269 87.40% 0.00% 1.49% 11.15% NA
Indica I  595 7.60% 0.20% 3.03% 89.24% NA
Indica II  465 14.80% 0.20% 4.09% 80.86% NA
Indica III  913 24.60% 0.40% 1.75% 73.17% NA
Indica Intermediate  786 23.50% 0.30% 2.04% 74.17% NA
Temperate Japonica  767 45.10% 52.90% 0.26% 1.69% NA
Tropical Japonica  504 72.60% 26.60% 0.00% 0.79% NA
Japonica Intermediate  241 70.10% 28.20% 0.00% 1.66% NA
VI/Aromatic  96 96.90% 1.00% 0.00% 2.08% NA
Intermediate  90 56.70% 13.30% 0.00% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0814576026 C -> T LOC_Os08g24130.1 upstream_gene_variant ; 1760.0bp to feature; MODIFIER silent_mutation Average:10.763; most accessible tissue: Callus, score: 65.33 N N N N
vg0814576026 C -> T LOC_Os08g24140.1 downstream_gene_variant ; 4070.0bp to feature; MODIFIER silent_mutation Average:10.763; most accessible tissue: Callus, score: 65.33 N N N N
vg0814576026 C -> T LOC_Os08g24130-LOC_Os08g24140 intergenic_region ; MODIFIER silent_mutation Average:10.763; most accessible tissue: Callus, score: 65.33 N N N N
vg0814576026 C -> DEL N N silent_mutation Average:10.763; most accessible tissue: Callus, score: 65.33 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0814576026 NA 7.40E-07 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814576026 8.77E-06 2.67E-07 mr1708 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814576026 4.40E-06 NA mr1182_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814576026 2.85E-06 2.64E-11 mr1282_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251