\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0814450879:

Variant ID: vg0814450879 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 14450879
Reference Allele: TTCAlternative Allele: T,CTC
Primary Allele: TTCSecondary Allele: CTC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTTCGCTACTATGAGTTGATGGGGAATAAAATTGTACGTGTTAGAAGTGGTATCATGTTGTGGGAGATGCTTAATTATGAAATAAAACAGAGTACTCTC[TTC/T,CTC]
GTTTCACAATGTAAATAATGTAAATATAAGTCCTTATAGTATTTTTTATATTCATATTGATGTTAATTTTCTATATTTATATTGATATTAATAAATTTAG

Reverse complement sequence

CTAAATTTATTAATATCAATATAAATATAGAAAATTAACATCAATATGAATATAAAAAATACTATAAGGACTTATATTTACATTATTTACATTGTGAAAC[GAA/A,GAG]
GAGAGTACTCTGTTTTATTTCATAATTAAGCATCTCCCACAACATGATACCACTTCTAACACGTACAATTTTATTCCCCATCAACTCATAGTAGCGAAGT

Allele Frequencies:

Populations Population SizeFrequency of TTC(primary allele) Frequency of CTC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.30% 11.20% 3.15% 0.25% T: 0.13%
All Indica  2759 98.50% 0.10% 0.83% 0.36% T: 0.18%
All Japonica  1512 71.40% 28.20% 0.40% 0.00% T: 0.07%
Aus  269 57.60% 0.00% 41.64% 0.74% NA
Indica I  595 99.50% 0.00% 0.34% 0.17% NA
Indica II  465 97.20% 0.20% 1.29% 1.08% T: 0.22%
Indica III  913 99.10% 0.10% 0.44% 0.11% T: 0.22%
Indica Intermediate  786 97.70% 0.30% 1.40% 0.38% T: 0.25%
Temperate Japonica  767 97.30% 2.50% 0.13% 0.00% T: 0.13%
Tropical Japonica  504 42.70% 56.90% 0.40% 0.00% NA
Japonica Intermediate  241 49.00% 49.80% 1.24% 0.00% NA
VI/Aromatic  96 12.50% 82.30% 5.21% 0.00% NA
Intermediate  90 74.40% 22.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0814450879 TTC -> DEL N N silent_mutation Average:56.014; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0814450879 TTC -> T LOC_Os08g23870.1 3_prime_UTR_variant ; 170.0bp to feature; MODIFIER silent_mutation Average:56.014; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0814450879 TTC -> T LOC_Os08g23880.1 upstream_gene_variant ; 3329.0bp to feature; MODIFIER silent_mutation Average:56.014; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0814450879 TTC -> CTC LOC_Os08g23870.1 3_prime_UTR_variant ; 169.0bp to feature; MODIFIER silent_mutation Average:56.014; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0814450879 TTC -> CTC LOC_Os08g23880.1 upstream_gene_variant ; 3330.0bp to feature; MODIFIER silent_mutation Average:56.014; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0814450879 NA 1.05E-13 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814450879 NA 6.89E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814450879 NA 2.79E-14 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814450879 NA 9.54E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814450879 NA 3.85E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814450879 NA 8.80E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814450879 NA 5.72E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814450879 NA 9.87E-06 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814450879 NA 8.05E-13 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814450879 NA 3.29E-10 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814450879 NA 2.92E-13 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814450879 NA 2.56E-07 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814450879 NA 7.09E-06 mr1858 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814450879 NA 7.10E-06 mr1859 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814450879 NA 4.30E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251