Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0814423056:

Variant ID: vg0814423056 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 14423056
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 150. )

Flanking Sequence (100 bp) in Reference Genome:

TAGACAACATTACAAAATGGACACACTTTTTCACAACTTAACAAACACTTGAAAGGCTCAAAGCAAAAGAGTTGTCTTCAGGTGCATTCAAGAGAACTCC[C/A]
CTAAGTAAGAGAAAAGAACACAAGTATCTACACAATTGATTCGTGTCATCCACAATAACTTCAAATGTAACCCTCACAATCTGCAATCCACAATAACTTC

Reverse complement sequence

GAAGTTATTGTGGATTGCAGATTGTGAGGGTTACATTTGAAGTTATTGTGGATGACACGAATCAATTGTGTAGATACTTGTGTTCTTTTCTCTTACTTAG[G/T]
GGAGTTCTCTTGAATGCACCTGAAGACAACTCTTTTGCTTTGAGCCTTTCAAGTGTTTGTTAAGTTGTGAAAAAGTGTGTCCATTTTGTAATGTTGTCTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.80%	19.20%	0.04%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	42.20%	57.70%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.80%	0.00%	0.00%	NA
Temperate Japonica	767	15.30%	84.70%	0.00%	0.00%	NA
Tropical Japonica	504	72.40%	27.60%	0.00%	0.00%	NA
Japonica Intermediate	241	64.70%	34.90%	0.41%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	77.80%	21.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0814423056	C -> A	LOC_Os08g23820.1	upstream_gene_variant ; 2278.0bp to feature; MODIFIER	silent_mutation	Average:54.417; most accessible tissue: Callus, score: 77.713	N	N	N	N
vg0814423056	C -> A	LOC_Os08g23810.1	downstream_gene_variant ; 4060.0bp to feature; MODIFIER	silent_mutation	Average:54.417; most accessible tissue: Callus, score: 77.713	N	N	N	N
vg0814423056	C -> A	LOC_Os08g23810.2	downstream_gene_variant ; 4060.0bp to feature; MODIFIER	silent_mutation	Average:54.417; most accessible tissue: Callus, score: 77.713	N	N	N	N
vg0814423056	C -> A	LOC_Os08g23810-LOC_Os08g23820	intergenic_region ; MODIFIER	silent_mutation	Average:54.417; most accessible tissue: Callus, score: 77.713	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0814423056	NA	5.18E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814423056	NA	8.39E-14	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814423056	NA	1.35E-15	mr1040_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814423056	NA	4.29E-54	mr1136_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814423056	NA	7.16E-34	mr1448_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814423056	NA	3.04E-11	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814423056	NA	1.45E-08	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814423056	NA	3.61E-14	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814423056	NA	5.80E-08	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814423056	NA	5.99E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814423056	NA	1.14E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251