Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0814423056:

Variant ID: vg0814423056 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 14423056
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 150. )

Flanking Sequence (100 bp) in Reference Genome:


TAGACAACATTACAAAATGGACACACTTTTTCACAACTTAACAAACACTTGAAAGGCTCAAAGCAAAAGAGTTGTCTTCAGGTGCATTCAAGAGAACTCC[C/A]
CTAAGTAAGAGAAAAGAACACAAGTATCTACACAATTGATTCGTGTCATCCACAATAACTTCAAATGTAACCCTCACAATCTGCAATCCACAATAACTTC

Reverse complement sequence

GAAGTTATTGTGGATTGCAGATTGTGAGGGTTACATTTGAAGTTATTGTGGATGACACGAATCAATTGTGTAGATACTTGTGTTCTTTTCTCTTACTTAG[G/T]
GGAGTTCTCTTGAATGCACCTGAAGACAACTCTTTTGCTTTGAGCCTTTCAAGTGTTTGTTAAGTTGTGAAAAAGTGTGTCCATTTTGTAATGTTGTCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.80% 19.20% 0.04% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 42.20% 57.70% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 15.30% 84.70% 0.00% 0.00% NA
Tropical Japonica  504 72.40% 27.60% 0.00% 0.00% NA
Japonica Intermediate  241 64.70% 34.90% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 77.80% 21.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0814423056 C -> A LOC_Os08g23820.1 upstream_gene_variant ; 2278.0bp to feature; MODIFIER silent_mutation Average:54.417; most accessible tissue: Callus, score: 77.713 N N N N
vg0814423056 C -> A LOC_Os08g23810.1 downstream_gene_variant ; 4060.0bp to feature; MODIFIER silent_mutation Average:54.417; most accessible tissue: Callus, score: 77.713 N N N N
vg0814423056 C -> A LOC_Os08g23810.2 downstream_gene_variant ; 4060.0bp to feature; MODIFIER silent_mutation Average:54.417; most accessible tissue: Callus, score: 77.713 N N N N
vg0814423056 C -> A LOC_Os08g23810-LOC_Os08g23820 intergenic_region ; MODIFIER silent_mutation Average:54.417; most accessible tissue: Callus, score: 77.713 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0814423056 NA 5.18E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814423056 NA 8.39E-14 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814423056 NA 1.35E-15 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814423056 NA 4.29E-54 mr1136_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814423056 NA 7.16E-34 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814423056 NA 3.04E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814423056 NA 1.45E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814423056 NA 3.61E-14 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814423056 NA 5.80E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814423056 NA 5.99E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814423056 NA 1.14E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251