\
| Variant ID: vg0814423056 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 14423056 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 150. )
TAGACAACATTACAAAATGGACACACTTTTTCACAACTTAACAAACACTTGAAAGGCTCAAAGCAAAAGAGTTGTCTTCAGGTGCATTCAAGAGAACTCC[C/A]
CTAAGTAAGAGAAAAGAACACAAGTATCTACACAATTGATTCGTGTCATCCACAATAACTTCAAATGTAACCCTCACAATCTGCAATCCACAATAACTTC
GAAGTTATTGTGGATTGCAGATTGTGAGGGTTACATTTGAAGTTATTGTGGATGACACGAATCAATTGTGTAGATACTTGTGTTCTTTTCTCTTACTTAG[G/T]
GGAGTTCTCTTGAATGCACCTGAAGACAACTCTTTTGCTTTGAGCCTTTCAAGTGTTTGTTAAGTTGTGAAAAAGTGTGTCCATTTTGTAATGTTGTCTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.80% | 19.20% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 42.20% | 57.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 15.30% | 84.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 72.40% | 27.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 64.70% | 34.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 21.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0814423056 | C -> A | LOC_Os08g23820.1 | upstream_gene_variant ; 2278.0bp to feature; MODIFIER | silent_mutation | Average:54.417; most accessible tissue: Callus, score: 77.713 | N | N | N | N |
| vg0814423056 | C -> A | LOC_Os08g23810.1 | downstream_gene_variant ; 4060.0bp to feature; MODIFIER | silent_mutation | Average:54.417; most accessible tissue: Callus, score: 77.713 | N | N | N | N |
| vg0814423056 | C -> A | LOC_Os08g23810.2 | downstream_gene_variant ; 4060.0bp to feature; MODIFIER | silent_mutation | Average:54.417; most accessible tissue: Callus, score: 77.713 | N | N | N | N |
| vg0814423056 | C -> A | LOC_Os08g23810-LOC_Os08g23820 | intergenic_region ; MODIFIER | silent_mutation | Average:54.417; most accessible tissue: Callus, score: 77.713 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0814423056 | NA | 5.18E-07 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814423056 | NA | 8.39E-14 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814423056 | NA | 1.35E-15 | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814423056 | NA | 4.29E-54 | mr1136_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814423056 | NA | 7.16E-34 | mr1448_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814423056 | NA | 3.04E-11 | mr1537_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814423056 | NA | 1.45E-08 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814423056 | NA | 3.61E-14 | mr1713_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814423056 | NA | 5.80E-08 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814423056 | NA | 5.99E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814423056 | NA | 1.14E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |