\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0814414168:

Variant ID: vg0814414168 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 14414168
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.03, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


GCCATATCCATCAAAATATGTATGGACATATCCCATCCATGCATGACCGTGAACCAAACACACCCTTAAGTATCCTATCCTCTAGTCTCTCTCTTGATTA[T/C]
GTGGAATGCACTGTTCTCAAGCAGTAGGTGCCACAAGCGATGGGCTTCTCAGCTCATCATGTTCACCACTCAGGGCCGAATGAAAAGCCCACCGACGCAG

Reverse complement sequence

CTGCGTCGGTGGGCTTTTCATTCGGCCCTGAGTGGTGAACATGATGAGCTGAGAAGCCCATCGCTTGTGGCACCTACTGCTTGAGAACAGTGCATTCCAC[A/G]
TAATCAAGAGAGAGACTAGAGGATAGGATACTTAAGGGTGTGTTTGGTTCACGGTCATGCATGGATGGGATATGTCCATACATATTTTGATGGATATGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.40% 47.10% 0.23% 0.30% NA
All Indica  2759 84.00% 15.40% 0.18% 0.40% NA
All Japonica  1512 5.10% 94.60% 0.26% 0.00% NA
Aus  269 16.00% 83.60% 0.00% 0.37% NA
Indica I  595 97.50% 2.20% 0.17% 0.17% NA
Indica II  465 87.70% 12.30% 0.00% 0.00% NA
Indica III  913 76.70% 22.30% 0.22% 0.77% NA
Indica Intermediate  786 80.00% 19.30% 0.25% 0.38% NA
Temperate Japonica  767 2.20% 97.80% 0.00% 0.00% NA
Tropical Japonica  504 10.50% 89.50% 0.00% 0.00% NA
Japonica Intermediate  241 2.90% 95.40% 1.66% 0.00% NA
VI/Aromatic  96 8.30% 90.60% 1.04% 0.00% NA
Intermediate  90 35.60% 61.10% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0814414168 T -> C LOC_Os08g23810.1 upstream_gene_variant ; 168.0bp to feature; MODIFIER silent_mutation Average:95.403; most accessible tissue: Minghui63 root, score: 98.079 N N N N
vg0814414168 T -> C LOC_Os08g23810.2 upstream_gene_variant ; 168.0bp to feature; MODIFIER silent_mutation Average:95.403; most accessible tissue: Minghui63 root, score: 98.079 N N N N
vg0814414168 T -> C LOC_Os08g23800.1 downstream_gene_variant ; 3583.0bp to feature; MODIFIER silent_mutation Average:95.403; most accessible tissue: Minghui63 root, score: 98.079 N N N N
vg0814414168 T -> C LOC_Os08g23800-LOC_Os08g23810 intergenic_region ; MODIFIER silent_mutation Average:95.403; most accessible tissue: Minghui63 root, score: 98.079 N N N N
vg0814414168 T -> DEL N N silent_mutation Average:95.403; most accessible tissue: Minghui63 root, score: 98.079 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0814414168 T C 0.08 0.08 0.06 0.03 0.04 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0814414168 NA 8.04E-07 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814414168 NA 6.74E-06 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814414168 NA 7.15E-17 mr1484 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814414168 NA 6.89E-06 mr1484 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814414168 NA 1.82E-12 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814414168 NA 3.47E-25 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814414168 NA 2.58E-07 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814414168 NA 1.61E-11 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814414168 5.95E-06 5.95E-06 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814414168 NA 2.16E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814414168 NA 2.14E-06 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251