\
| Variant ID: vg0814303967 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 14303967 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 159. )
TGGCTAGGGAGGATGAGGAAAAAACTGCATTCATTACCCCCATAGGAACTTATTGTTATACGACAATGCCTTTCGGGTTAAAGAACGCAGGTCCTACTTT[T/C]
CAACGTACTACTCGAATTTCTTTGGGTAGCCAGATAGGACGCAATGTTGAGGCCTATGTTGATGACTTGGTTGTAAAGACGCGCAACCAAGAGACCTTAC
GTAAGGTCTCTTGGTTGCGCGTCTTTACAACCAAGTCATCAACATAGGCCTCAACATTGCGTCCTATCTGGCTACCCAAAGAAATTCGAGTAGTACGTTG[A/G]
AAAGTAGGACCTGCGTTCTTTAACCCGAAAGGCATTGTCGTATAACAATAAGTTCCTATGGGGGTAATGAATGCAGTTTTTTCCTCATCCTCCCTAGCCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.80% | 22.50% | 12.89% | 5.73% | NA |
| All Indica | 2759 | 92.20% | 6.10% | 1.59% | 0.07% | NA |
| All Japonica | 1512 | 2.50% | 56.70% | 24.27% | 16.47% | NA |
| Aus | 269 | 58.40% | 3.00% | 38.66% | 0.00% | NA |
| Indica I | 595 | 96.60% | 2.40% | 1.01% | 0.00% | NA |
| Indica II | 465 | 91.60% | 6.00% | 2.15% | 0.22% | NA |
| Indica III | 913 | 91.90% | 6.70% | 1.42% | 0.00% | NA |
| Indica Intermediate | 786 | 89.70% | 8.30% | 1.91% | 0.13% | NA |
| Temperate Japonica | 767 | 2.50% | 84.60% | 3.26% | 9.65% | NA |
| Tropical Japonica | 504 | 2.40% | 24.00% | 58.53% | 15.08% | NA |
| Japonica Intermediate | 241 | 2.90% | 36.50% | 19.50% | 41.08% | NA |
| VI/Aromatic | 96 | 6.20% | 3.10% | 77.08% | 13.54% | NA |
| Intermediate | 90 | 38.90% | 31.10% | 22.22% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0814303967 | T -> C | LOC_Os08g23630.1 | synonymous_variant ; p.Phe874Phe; LOW | synonymous_codon | Average:10.822; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0814303967 | T -> DEL | LOC_Os08g23630.1 | N | frameshift_variant | Average:10.822; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0814303967 | NA | 8.97E-07 | mr1134 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814303967 | NA | 6.05E-06 | mr1135 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814303967 | NA | 2.06E-06 | mr1708 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814303967 | NA | 4.76E-09 | mr1134_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814303967 | NA | 4.43E-06 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814303967 | NA | 2.55E-06 | mr1504_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814303967 | NA | 1.12E-07 | mr1521_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814303967 | NA | 6.73E-08 | mr1672_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814303967 | NA | 4.64E-09 | mr1746_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814303967 | NA | 2.00E-08 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |