\
| Variant ID: vg0814102960 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 14102960 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 241. )
CTTTTCGACCCAAACTTAAAAAAGAAATAAATCACTTAGTGATTTCAAAATGATTTCAAATAAAGGATTTGCAAAACAACCTTGCCTCTCTTCCAAGCTT[G/A]
CATTAAACACCTAAATTCCCGTGACTTGCGGAGTACGAAAGTACTTATCCTTGATCTATATAAATATATATAGTTCCTCCGCCCTGAAGTTGAAGATGAA
TTCATCTTCAACTTCAGGGCGGAGGAACTATATATATTTATATAGATCAAGGATAAGTACTTTCGTACTCCGCAAGTCACGGGAATTTAGGTGTTTAATG[C/T]
AAGCTTGGAAGAGAGGCAAGGTTGTTTTGCAAATCCTTTATTTGAAATCATTTTGAAATCACTAAGTGATTTATTTCTTTTTTAAGTTTGGGTCGAAAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 72.00% | 28.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 42.90% | 57.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 51.00% | 49.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 16.70% | 83.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0814102960 | G -> A | LOC_Os08g23350.1 | upstream_gene_variant ; 2262.0bp to feature; MODIFIER | silent_mutation | Average:48.199; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| vg0814102960 | G -> A | LOC_Os08g23360.1 | downstream_gene_variant ; 3147.0bp to feature; MODIFIER | silent_mutation | Average:48.199; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| vg0814102960 | G -> A | LOC_Os08g23350-LOC_Os08g23360 | intergenic_region ; MODIFIER | silent_mutation | Average:48.199; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0814102960 | NA | 1.28E-11 | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814102960 | NA | 2.40E-12 | mr1205 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814102960 | NA | 1.79E-06 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814102960 | NA | 2.08E-14 | mr1330 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814102960 | NA | 2.24E-10 | mr1332 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814102960 | NA | 4.97E-12 | mr1454 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814102960 | 2.29E-06 | NA | mr1504 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814102960 | NA | 3.33E-14 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814102960 | NA | 7.07E-08 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814102960 | NA | 1.95E-08 | mr1851 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |