\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0814102960:

Variant ID: vg0814102960 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 14102960
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTTCGACCCAAACTTAAAAAAGAAATAAATCACTTAGTGATTTCAAAATGATTTCAAATAAAGGATTTGCAAAACAACCTTGCCTCTCTTCCAAGCTT[G/A]
CATTAAACACCTAAATTCCCGTGACTTGCGGAGTACGAAAGTACTTATCCTTGATCTATATAAATATATATAGTTCCTCCGCCCTGAAGTTGAAGATGAA

Reverse complement sequence

TTCATCTTCAACTTCAGGGCGGAGGAACTATATATATTTATATAGATCAAGGATAAGTACTTTCGTACTCCGCAAGTCACGGGAATTTAGGTGTTTAATG[C/T]
AAGCTTGGAAGAGAGGCAAGGTTGTTTTGCAAATCCTTTATTTGAAATCATTTTGAAATCACTAAGTGATTTATTTCTTTTTTAAGTTTGGGTCGAAAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.90% 11.10% 0.00% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 72.00% 28.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 97.70% 2.30% 0.00% 0.00% NA
Tropical Japonica  504 42.90% 57.10% 0.00% 0.00% NA
Japonica Intermediate  241 51.00% 49.00% 0.00% 0.00% NA
VI/Aromatic  96 16.70% 83.30% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0814102960 G -> A LOC_Os08g23350.1 upstream_gene_variant ; 2262.0bp to feature; MODIFIER silent_mutation Average:48.199; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg0814102960 G -> A LOC_Os08g23360.1 downstream_gene_variant ; 3147.0bp to feature; MODIFIER silent_mutation Average:48.199; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg0814102960 G -> A LOC_Os08g23350-LOC_Os08g23360 intergenic_region ; MODIFIER silent_mutation Average:48.199; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0814102960 NA 1.28E-11 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814102960 NA 2.40E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814102960 NA 1.79E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814102960 NA 2.08E-14 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814102960 NA 2.24E-10 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814102960 NA 4.97E-12 mr1454 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814102960 2.29E-06 NA mr1504 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814102960 NA 3.33E-14 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814102960 NA 7.07E-08 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814102960 NA 1.95E-08 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251