Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0814102960:

Variant ID: vg0814102960 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 14102960
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

CTTTTCGACCCAAACTTAAAAAAGAAATAAATCACTTAGTGATTTCAAAATGATTTCAAATAAAGGATTTGCAAAACAACCTTGCCTCTCTTCCAAGCTT[G/A]
CATTAAACACCTAAATTCCCGTGACTTGCGGAGTACGAAAGTACTTATCCTTGATCTATATAAATATATATAGTTCCTCCGCCCTGAAGTTGAAGATGAA

Reverse complement sequence

TTCATCTTCAACTTCAGGGCGGAGGAACTATATATATTTATATAGATCAAGGATAAGTACTTTCGTACTCCGCAAGTCACGGGAATTTAGGTGTTTAATG[C/T]
AAGCTTGGAAGAGAGGCAAGGTTGTTTTGCAAATCCTTTATTTGAAATCATTTTGAAATCACTAAGTGATTTATTTCTTTTTTAAGTTTGGGTCGAAAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.90%	11.10%	0.00%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	72.00%	28.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	97.70%	2.30%	0.00%	0.00%	NA
Tropical Japonica	504	42.90%	57.10%	0.00%	0.00%	NA
Japonica Intermediate	241	51.00%	49.00%	0.00%	0.00%	NA
VI/Aromatic	96	16.70%	83.30%	0.00%	0.00%	NA
Intermediate	90	80.00%	20.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0814102960	G -> A	LOC_Os08g23350.1	upstream_gene_variant ; 2262.0bp to feature; MODIFIER	silent_mutation	Average:48.199; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N
vg0814102960	G -> A	LOC_Os08g23360.1	downstream_gene_variant ; 3147.0bp to feature; MODIFIER	silent_mutation	Average:48.199; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N
vg0814102960	G -> A	LOC_Os08g23350-LOC_Os08g23360	intergenic_region ; MODIFIER	silent_mutation	Average:48.199; most accessible tissue: Zhenshan97 flag leaf, score: 63.67	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0814102960	NA	1.28E-11	mr1084	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814102960	NA	2.40E-12	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814102960	NA	1.79E-06	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814102960	NA	2.08E-14	mr1330	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814102960	NA	2.24E-10	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814102960	NA	4.97E-12	mr1454	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814102960	2.29E-06	NA	mr1504	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814102960	NA	3.33E-14	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814102960	NA	7.07E-08	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814102960	NA	1.95E-08	mr1851	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251