Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0814055215:

Variant ID: vg0814055215 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 14055215
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTTCTATACAAAAGTTGCTTAAAATATCATAATGATCCATTTTTTTAAAAAAATAGCTAATACTTATTTAATCACGTATCAATAGACTACTCCTTTTTC[G/A]
TGTGGAGGAGTTTTGTTCCCATCCACCCAAAACTAACACAGCCTGAGCAGTTAAGATGACTAGCCCCAACGTTTGGCATATTGAAGAAAAAAGCAAAACG

Reverse complement sequence

CGTTTTGCTTTTTTCTTCAATATGCCAAACGTTGGGGCTAGTCATCTTAACTGCTCAGGCTGTGTTAGTTTTGGGTGGATGGGAACAAAACTCCTCCACA[C/T]
GAAAAAGGAGTAGTCTATTGATACGTGATTAAATAAGTATTAGCTATTTTTTTAAAAAAATGGATCATTATGATATTTTAAGCAACTTTTGTATAGAAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.10% 10.70% 1.18% 0.00% NA
All Indica  2759 99.80% 0.10% 0.04% 0.00% NA
All Japonica  1512 63.80% 32.70% 3.51% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 51.60% 42.40% 6.00% 0.00% NA
Tropical Japonica  504 77.20% 22.20% 0.60% 0.00% NA
Japonica Intermediate  241 74.70% 23.70% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 7.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0814055215 G -> A LOC_Os08g23290.1 upstream_gene_variant ; 855.0bp to feature; MODIFIER silent_mutation Average:52.555; most accessible tissue: Callus, score: 83.659 N N N N
vg0814055215 G -> A LOC_Os08g23280.1 downstream_gene_variant ; 3862.0bp to feature; MODIFIER silent_mutation Average:52.555; most accessible tissue: Callus, score: 83.659 N N N N
vg0814055215 G -> A LOC_Os08g23280-LOC_Os08g23290 intergenic_region ; MODIFIER silent_mutation Average:52.555; most accessible tissue: Callus, score: 83.659 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0814055215 2.54E-06 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814055215 1.51E-06 NA mr1080 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814055215 1.34E-07 NA mr1140 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814055215 2.24E-06 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814055215 4.27E-08 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814055215 NA 1.37E-07 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814055215 1.06E-06 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814055215 2.37E-07 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251