Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0814029225:

Variant ID: vg0814029225 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 14029225
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGCGAGAATTTAAATAAAGCGATAACGCATTAATTTAAATCAAAATAATTTTATAAACTGGGATTCAATATGTTCAAGGATGATGTGACTTGCCTTGCT[C/T]
GCTTTCCCAAACGTCGGCTTCAACCTCCACGAAGAGTGGATCTTCCGAAGCTGCAGCGTCTACACGACCAACGGAAACGAAAAAGGCTTTTACTCTAATA

Reverse complement sequence

TATTAGAGTAAAAGCCTTTTTCGTTTCCGTTGGTCGTGTAGACGCTGCAGCTTCGGAAGATCCACTCTTCGTGGAGGTTGAAGCCGACGTTTGGGAAAGC[G/A]
AGCAAGGCAAGTCACATCATCCTTGAACATATTGAATCCCAGTTTATAAAATTATTTTGATTTAAATTAATGCGTTATCGCTTTATTTAAATTCTCGCGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.40%	5.80%	1.27%	15.45%	NA
All Indica	2759	90.90%	1.50%	1.78%	5.80%	NA
All Japonica	1512	67.90%	0.30%	0.40%	31.42%	NA
Aus	269	17.10%	82.50%	0.00%	0.37%	NA
Indica I	595	98.20%	0.00%	0.34%	1.51%	NA
Indica II	465	95.70%	0.00%	0.43%	3.87%	NA
Indica III	913	86.00%	1.00%	3.72%	9.31%	NA
Indica Intermediate	786	88.40%	4.10%	1.40%	6.11%	NA
Temperate Japonica	767	90.00%	0.00%	0.13%	9.91%	NA
Tropical Japonica	504	43.10%	0.60%	0.79%	55.56%	NA
Japonica Intermediate	241	49.80%	0.40%	0.41%	49.38%	NA
VI/Aromatic	96	13.50%	4.20%	4.17%	78.12%	NA
Intermediate	90	72.20%	5.60%	1.11%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0814029225	C -> T	LOC_Os08g23230.1	upstream_gene_variant ; 2282.0bp to feature; MODIFIER	silent_mutation	Average:24.31; most accessible tissue: Minghui63 flag leaf, score: 35.832	N	N	N	N
vg0814029225	C -> T	LOC_Os08g23240.1	upstream_gene_variant ; 1600.0bp to feature; MODIFIER	silent_mutation	Average:24.31; most accessible tissue: Minghui63 flag leaf, score: 35.832	N	N	N	N
vg0814029225	C -> T	LOC_Os08g23230-LOC_Os08g23240	intergenic_region ; MODIFIER	silent_mutation	Average:24.31; most accessible tissue: Minghui63 flag leaf, score: 35.832	N	N	N	N
vg0814029225	C -> DEL	N	N	silent_mutation	Average:24.31; most accessible tissue: Minghui63 flag leaf, score: 35.832	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0814029225	NA	2.45E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	2.54E-15	mr1158	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	4.96E-24	mr1168	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	6.17E-14	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	4.82E-10	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	4.94E-06	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	1.42E-06	NA	mr1275	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	8.58E-06	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	2.95E-08	mr1348	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	7.43E-06	mr1393	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	5.76E-07	mr1415	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	1.18E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	5.36E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	6.73E-21	mr1515	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	1.43E-39	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	3.08E-43	mr1550	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	2.83E-08	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	5.76E-07	mr1567	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	2.98E-06	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	7.34E-25	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	1.91E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	1.94E-11	mr1649	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	2.92E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	2.52E-07	mr1669	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	4.02E-08	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	1.48E-09	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	7.47E-38	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	2.49E-07	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	1.94E-09	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	1.75E-07	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	3.29E-12	mr1897	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	6.72E-10	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	1.69E-06	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	4.41E-32	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	6.89E-16	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	8.68E-12	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814029225	NA	2.90E-08	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251