Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813870955:

Variant ID: vg0813870955 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 13870955
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTTCCGCTGCAGATCAAGTCAAGGCTTAGCTCCAGTTATCTTTTGTTTTTCTGTTGCATTTATGTAAGACTTTGATAATGTTTGTAAGACGTGGATCT[A/G]
TATGTCAACTTTGTCGTTTGTGTATCCCGGCCGGTCCTGGACGAGGATTTTAATGCACATTCTGCTTGGAATTCTATTCGGGAATTTCTGGGCGTGACAA

Reverse complement sequence

TTGTCACGCCCAGAAATTCCCGAATAGAATTCCAAGCAGAATGTGCATTAAAATCCTCGTCCAGGACCGGCCGGGATACACAAACGACAAAGTTGACATA[T/C]
AGATCCACGTCTTACAAACATTATCAAAGTCTTACATAAATGCAACAGAAAAACAAAAGATAACTGGAGCTAAGCCTTGACTTGATCTGCAGCGGAAACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.70% 19.20% 0.04% 0.00% NA
All Indica  2759 98.80% 1.20% 0.07% 0.00% NA
All Japonica  1512 43.80% 56.20% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 96.80% 2.80% 0.43% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.30% 0.00% 0.00% NA
Temperate Japonica  767 15.50% 84.50% 0.00% 0.00% NA
Tropical Japonica  504 76.00% 24.00% 0.00% 0.00% NA
Japonica Intermediate  241 66.40% 33.60% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0813870955 A -> G LOC_Os08g23030.1 upstream_gene_variant ; 1798.0bp to feature; MODIFIER silent_mutation Average:32.126; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0813870955 A -> G LOC_Os08g23040.1 upstream_gene_variant ; 832.0bp to feature; MODIFIER silent_mutation Average:32.126; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0813870955 A -> G LOC_Os08g23050.1 upstream_gene_variant ; 1854.0bp to feature; MODIFIER silent_mutation Average:32.126; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0813870955 A -> G LOC_Os08g23020.1 downstream_gene_variant ; 3360.0bp to feature; MODIFIER silent_mutation Average:32.126; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N
vg0813870955 A -> G LOC_Os08g23030-LOC_Os08g23040 intergenic_region ; MODIFIER silent_mutation Average:32.126; most accessible tissue: Zhenshan97 flag leaf, score: 60.074 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0813870955 NA 1.12E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0813870955 NA 6.25E-16 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0813870955 NA 5.09E-11 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0813870955 NA 5.17E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 8.85E-33 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 2.83E-06 NA mr1164 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 6.36E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 1.25E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 8.31E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 2.38E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 1.61E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 9.23E-08 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 3.36E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 3.52E-26 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 2.51E-07 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 1.06E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 1.03E-24 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 2.71E-33 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 9.26E-06 mr1170_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 8.20E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 1.67E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 4.65E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 2.00E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 4.93E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 8.14E-22 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 1.27E-08 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 2.18E-10 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870955 NA 3.44E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251