Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813870236:

Variant ID: vg0813870236 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 13870236
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

CGGCTGGGCTTGTAGTGTAGCTTTCCTCTAGCTGACGCATCCAGGCGAGGGTGAGCGTGATGGAGTTTGGATGGGCCCTGCGATGGCCTATGCGGCTTCC[A/G]
GATTCACCTAGGCACGAGAAGGGACTGCCCGCTGCCTTGCGAGGAGTGGGGGGGAAACCTGAGGTGTGGTGTGCTTGGTTAGAGGGGGTTATGCGAAGGG

Reverse complement sequence

CCCTTCGCATAACCCCCTCTAACCAAGCACACCACACCTCAGGTTTCCCCCCCACTCCTCGCAAGGCAGCGGGCAGTCCCTTCTCGTGCCTAGGTGAATC[T/C]
GGAAGCCGCATAGGCCATCGCAGGGCCCATCCAAACTCCATCACGCTCACCCTCGCCTGGATGCGTCAGCTAGAGGAAAGCTACACTACAAGCCCAGCCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.50%	7.20%	3.60%	0.72%	NA
All Indica	2759	98.60%	0.70%	0.65%	0.04%	NA
All Japonica	1512	76.50%	20.20%	3.37%	0.00%	NA
Aus	269	53.90%	0.40%	33.46%	12.27%	NA
Indica I	595	98.80%	0.80%	0.34%	0.00%	NA
Indica II	465	97.40%	1.30%	1.29%	0.00%	NA
Indica III	913	99.10%	0.70%	0.22%	0.00%	NA
Indica Intermediate	786	98.60%	0.30%	1.02%	0.13%	NA
Temperate Japonica	767	58.10%	36.20%	5.61%	0.00%	NA
Tropical Japonica	504	98.00%	1.60%	0.40%	0.00%	NA
Japonica Intermediate	241	89.60%	7.90%	2.49%	0.00%	NA
VI/Aromatic	96	96.90%	1.00%	2.08%	0.00%	NA
Intermediate	90	75.60%	14.40%	10.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0813870236	A -> G	LOC_Os08g23030.1	upstream_gene_variant ; 1079.0bp to feature; MODIFIER	silent_mutation	Average:16.022; most accessible tissue: Zhenshan97 flag leaf, score: 21.009	N	N	N	N
vg0813870236	A -> G	LOC_Os08g23040.1	upstream_gene_variant ; 1551.0bp to feature; MODIFIER	silent_mutation	Average:16.022; most accessible tissue: Zhenshan97 flag leaf, score: 21.009	N	N	N	N
vg0813870236	A -> G	LOC_Os08g23050.1	upstream_gene_variant ; 2573.0bp to feature; MODIFIER	silent_mutation	Average:16.022; most accessible tissue: Zhenshan97 flag leaf, score: 21.009	N	N	N	N
vg0813870236	A -> G	LOC_Os08g23020.1	downstream_gene_variant ; 2641.0bp to feature; MODIFIER	silent_mutation	Average:16.022; most accessible tissue: Zhenshan97 flag leaf, score: 21.009	N	N	N	N
vg0813870236	A -> G	LOC_Os08g23030-LOC_Os08g23040	intergenic_region ; MODIFIER	silent_mutation	Average:16.022; most accessible tissue: Zhenshan97 flag leaf, score: 21.009	N	N	N	N
vg0813870236	A -> DEL	N	N	silent_mutation	Average:16.022; most accessible tissue: Zhenshan97 flag leaf, score: 21.009	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0813870236	1.87E-07	NA	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870236	NA	3.97E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870236	NA	4.78E-06	mr1912_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870236	6.87E-07	6.84E-07	mr1919_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813870236	NA	3.75E-06	mr1957_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251