\
| Variant ID: vg0813705372 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 13705372 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, C: 0.05, others allele: 0.00, population size: 108. )
ACATCTTCGCTTGGAAGCCGTCGGACATGCCTGGGGTCCCCAGGGAGGTGATCGAGCACCACCTCGCCGTGCGGTCGGATGCGTGACCCATCTGGCAGAA[G/C]
ATACGGCGCCAAGCCCCGGAGCGACAAGCCTTCATCCGCGAGGTGACGCGGCTCCTGGAGGCCGGCTTCATCCGAGAGGTCATCTACCCAGAGTGGCTGG
CCAGCCACTCTGGGTAGATGACCTCTCGGATGAAGCCGGCCTCCAGGAGCCGCGTCACCTCGCGGATGAAGGCTTGTCGCTCCGGGGCTTGGCGCCGTAT[C/G]
TTCTGCCAGATGGGTCACGCATCCGACCGCACGGCGAGGTGGTGCTCGATCACCTCCCTGGGGACCCCAGGCATGTCCGACGGCTTCCAAGCGAAGATGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.30% | 48.20% | 0.08% | 0.40% | NA |
| All Indica | 2759 | 84.10% | 15.40% | 0.00% | 0.54% | NA |
| All Japonica | 1512 | 1.90% | 97.90% | 0.20% | 0.00% | NA |
| Aus | 269 | 16.40% | 83.30% | 0.00% | 0.37% | NA |
| Indica I | 595 | 97.50% | 2.00% | 0.00% | 0.50% | NA |
| Indica II | 465 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 77.10% | 21.90% | 0.00% | 0.99% | NA |
| Indica Intermediate | 786 | 79.90% | 19.70% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 2.10% | 97.80% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 96.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 62.20% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0813705372 | G -> C | LOC_Os08g22790.1 | missense_variant ; p.Asp398His; MODERATE | nonsynonymous_codon ; D398R | Average:71.722; most accessible tissue: Zhenshan97 young leaf, score: 86.852 | unknown | unknown | TOLERATED | 0.31 |
| vg0813705372 | G -> C | LOC_Os08g22790.1 | missense_variant ; p.Asp398His; MODERATE | nonsynonymous_codon ; D398H | Average:71.722; most accessible tissue: Zhenshan97 young leaf, score: 86.852 | unknown | unknown | TOLERATED | 1.00 |
| vg0813705372 | G -> DEL | LOC_Os08g22790.1 | N | frameshift_variant | Average:71.722; most accessible tissue: Zhenshan97 young leaf, score: 86.852 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0813705372 | NA | 6.85E-07 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813705372 | NA | 2.39E-13 | mr1270 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813705372 | NA | 1.51E-06 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813705372 | NA | 4.08E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813705372 | NA | 2.92E-28 | mr1426 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813705372 | NA | 1.03E-15 | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813705372 | NA | 3.81E-11 | mr1581 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813705372 | NA | 1.50E-12 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813705372 | 4.40E-06 | NA | mr1704 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813705372 | NA | 2.06E-07 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813705372 | NA | 1.59E-25 | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813705372 | NA | 6.04E-08 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813705372 | NA | 1.03E-13 | mr1883 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813705372 | 7.04E-06 | 7.04E-06 | mr1883 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813705372 | 9.66E-07 | 9.65E-07 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813705372 | NA | 5.78E-10 | mr1945 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |