\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813685508:

Variant ID: vg0813685508 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 13685508
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTTCATAGGTTGAGACATTGTCTTGTCCCGAGAAATTCGAAAAATCTGGAACTTTGTATCAGTTAGGCAATTGAACCCTCTCGAACCACTCAGGGTTC[A/G]
AATGCCAATATAAGTTTCCAGTGTCCTTTGTCTTAAGCCCGAATTGCTCCCTCATCATATCTGCAATCAGATCGGCCCATGGTCTCTGCTGAGGCACCCC

Reverse complement sequence

GGGGTGCCTCAGCAGAGACCATGGGCCGATCTGATTGCAGATATGATGAGGGAGCAATTCGGGCTTAAGACAAAGGACACTGGAAACTTATATTGGCATT[T/C]
GAACCCTGAGTGGTTCGAGAGGGTTCAATTGCCTAACTGATACAAAGTTCCAGATTTTTCGAATTTCTCGGGACAAGACAATGTCTCAACCTATGAACAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.30% 20.30% 0.08% 3.28% NA
All Indica  2759 96.00% 0.70% 0.11% 3.15% NA
All Japonica  1512 44.10% 55.80% 0.00% 0.07% NA
Aus  269 48.70% 27.50% 0.37% 23.42% NA
Indica I  595 96.10% 0.20% 0.17% 3.53% NA
Indica II  465 97.60% 1.50% 0.00% 0.86% NA
Indica III  913 95.10% 0.30% 0.00% 4.60% NA
Indica Intermediate  786 96.20% 1.00% 0.25% 2.54% NA
Temperate Japonica  767 15.80% 84.20% 0.00% 0.00% NA
Tropical Japonica  504 76.40% 23.60% 0.00% 0.00% NA
Japonica Intermediate  241 66.80% 32.80% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 73.30% 23.30% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0813685508 A -> G LOC_Os08g22760.1 missense_variant ; p.Leu330Ser; MODERATE nonsynonymous_codon ; L330P Average:56.094; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 unknown unknown TOLERATED 0.82
vg0813685508 A -> G LOC_Os08g22760.1 missense_variant ; p.Leu330Ser; MODERATE nonsynonymous_codon ; L330S Average:56.094; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 unknown unknown TOLERATED 0.48
vg0813685508 A -> DEL LOC_Os08g22760.1 N frameshift_variant Average:56.094; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0813685508 NA 1.12E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0813685508 NA 5.09E-11 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0813685508 NA 8.53E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 5.17E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 6.36E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 1.25E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 8.31E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 1.61E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 9.23E-08 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 3.36E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 2.56E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 1.06E-12 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 2.03E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 8.16E-08 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 1.06E-08 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 1.09E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 1.92E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 9.26E-06 mr1170_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 8.20E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 1.67E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 4.65E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 2.00E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 4.93E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 4.56E-23 mr1746_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 1.27E-08 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 2.18E-10 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508 NA 3.44E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251