Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813685508:

Variant ID: vg0813685508 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 13685508
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTTCATAGGTTGAGACATTGTCTTGTCCCGAGAAATTCGAAAAATCTGGAACTTTGTATCAGTTAGGCAATTGAACCCTCTCGAACCACTCAGGGTTC[A/G]
AATGCCAATATAAGTTTCCAGTGTCCTTTGTCTTAAGCCCGAATTGCTCCCTCATCATATCTGCAATCAGATCGGCCCATGGTCTCTGCTGAGGCACCCC

Reverse complement sequence

GGGGTGCCTCAGCAGAGACCATGGGCCGATCTGATTGCAGATATGATGAGGGAGCAATTCGGGCTTAAGACAAAGGACACTGGAAACTTATATTGGCATT[T/C]
GAACCCTGAGTGGTTCGAGAGGGTTCAATTGCCTAACTGATACAAAGTTCCAGATTTTTCGAATTTCTCGGGACAAGACAATGTCTCAACCTATGAACAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.30%	20.30%	0.08%	3.28%	NA
All Indica	2759	96.00%	0.70%	0.11%	3.15%	NA
All Japonica	1512	44.10%	55.80%	0.00%	0.07%	NA
Aus	269	48.70%	27.50%	0.37%	23.42%	NA
Indica I	595	96.10%	0.20%	0.17%	3.53%	NA
Indica II	465	97.60%	1.50%	0.00%	0.86%	NA
Indica III	913	95.10%	0.30%	0.00%	4.60%	NA
Indica Intermediate	786	96.20%	1.00%	0.25%	2.54%	NA
Temperate Japonica	767	15.80%	84.20%	0.00%	0.00%	NA
Tropical Japonica	504	76.40%	23.60%	0.00%	0.00%	NA
Japonica Intermediate	241	66.80%	32.80%	0.00%	0.41%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	73.30%	23.30%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0813685508	A -> G	LOC_Os08g22760.1	missense_variant ; p.Leu330Ser; MODERATE	nonsynonymous_codon ; L330P	Average:56.094; most accessible tissue: Zhenshan97 flag leaf, score: 75.761	unknown	unknown	TOLERATED	0.82
vg0813685508	A -> G	LOC_Os08g22760.1	missense_variant ; p.Leu330Ser; MODERATE	nonsynonymous_codon ; L330S	Average:56.094; most accessible tissue: Zhenshan97 flag leaf, score: 75.761	unknown	unknown	TOLERATED	0.48
vg0813685508	A -> DEL	LOC_Os08g22760.1	N	frameshift_variant	Average:56.094; most accessible tissue: Zhenshan97 flag leaf, score: 75.761	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0813685508	NA	1.12E-12	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0813685508	NA	5.09E-11	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0813685508	NA	8.53E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	5.17E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	6.36E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	1.25E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	8.31E-08	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	1.61E-06	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	9.23E-08	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	3.36E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	2.56E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	1.06E-12	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	2.03E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	8.16E-08	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	1.06E-08	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	1.09E-10	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	1.92E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	9.26E-06	mr1170_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	8.20E-08	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	1.67E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	4.65E-06	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	2.00E-08	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	4.93E-10	mr1580_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	4.56E-23	mr1746_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	1.27E-08	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	2.18E-10	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813685508	NA	3.44E-10	mr1825_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251