\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813654729:

Variant ID: vg0813654729 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 13654729
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, A: 0.32, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGGGATTCCACAGGGGATTTTAGCCGATCTTATGCTAGGGGAAATCGGCTAATTCAGAGGAGGCTGCCTGTTCATCAGAGGTTAGGTCCGATACATCA[A/G]
GATTGCTTTCAGGATGAGGATGAGGGCAAGAATTCGCAATGGTGCCCTTCTGGCATTTTTACCAAGAATTAGAAGAGAAAGGTCCAGAGGATGAGGAACA

Reverse complement sequence

TGTTCCTCATCCTCTGGACCTTTCTCTTCTAATTCTTGGTAAAAATGCCAGAAGGGCACCATTGCGAATTCTTGCCCTCATCCTCATCCTGAAAGCAATC[T/C]
TGATGTATCGGACCTAACCTCTGATGAACAGGCAGCCTCCTCTGAATTAGCCGATTTCCCCTAGCATAAGATCGGCTAAAATCCCCTGTGGAATCCCAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 19.00% 16.20% 0.21% 64.56% NA
All Indica  2759 1.10% 15.60% 0.11% 83.25% NA
All Japonica  1512 56.20% 13.80% 0.13% 29.89% NA
Aus  269 0.40% 37.90% 0.74% 60.97% NA
Indica I  595 0.80% 3.00% 0.34% 95.80% NA
Indica II  465 1.90% 11.60% 0.00% 86.45% NA
Indica III  913 0.40% 22.80% 0.11% 76.67% NA
Indica Intermediate  786 1.40% 19.10% 0.00% 79.52% NA
Temperate Japonica  767 84.40% 11.30% 0.13% 4.17% NA
Tropical Japonica  504 24.00% 17.50% 0.20% 58.33% NA
Japonica Intermediate  241 33.60% 14.10% 0.00% 52.28% NA
VI/Aromatic  96 0.00% 8.30% 0.00% 91.67% NA
Intermediate  90 23.30% 17.80% 3.33% 55.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0813654729 A -> G LOC_Os08g22710.1 upstream_gene_variant ; 193.0bp to feature; MODIFIER silent_mutation Average:14.322; most accessible tissue: Callus, score: 51.426 N N N N
vg0813654729 A -> G LOC_Os08g22700.1 downstream_gene_variant ; 802.0bp to feature; MODIFIER silent_mutation Average:14.322; most accessible tissue: Callus, score: 51.426 N N N N
vg0813654729 A -> G LOC_Os08g22700-LOC_Os08g22710 intergenic_region ; MODIFIER silent_mutation Average:14.322; most accessible tissue: Callus, score: 51.426 N N N N
vg0813654729 A -> DEL N N silent_mutation Average:14.322; most accessible tissue: Callus, score: 51.426 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0813654729 NA 6.24E-07 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813654729 NA 3.85E-06 mr1484 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813654729 NA 8.18E-06 mr1609 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813654729 NA 1.10E-06 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813654729 1.94E-06 1.94E-06 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813654729 NA 7.28E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813654729 NA 1.64E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813654729 NA 4.21E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813654729 NA 2.66E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813654729 NA 1.25E-07 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813654729 NA 5.57E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813654729 NA 9.61E-07 mr1405_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813654729 4.28E-06 4.28E-06 mr1592_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813654729 NA 4.90E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813654729 NA 6.49E-06 mr1713_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813654729 NA 4.64E-06 mr1728_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813654729 NA 1.03E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251