\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813652482:

Variant ID: vg0813652482 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 13652482
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AATAATGGGGTTCAATATGTTCAAGGAATATGGTATGACTTGCCTTGCTCGAAAAGGTCTTATGACGACTTGATCTGCACTTCGGGAACTCCCGAAATGA[C/T]
GGCAGCTACACGAACACAAAACAAGGCTACAACTCTAAGAAAGAAATGATAACAATACATAAAAACAACAAACACGAGTTCTTTAAGTTATAACAAAAAT

Reverse complement sequence

ATTTTTGTTATAACTTAAAGAACTCGTGTTTGTTGTTTTTATGTATTGTTATCATTTCTTTCTTAGAGTTGTAGCCTTGTTTTGTGTTCGTGTAGCTGCC[G/A]
TCATTTCGGGAGTTCCCGAAGTGCAGATCAAGTCGTCATAAGACCTTTTCGAGCAAGGCAAGTCATACCATATTCCTTGAACATATTGAACCCCATTATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.90% 5.80% 18.73% 44.52% NA
All Indica  2759 8.50% 9.70% 24.14% 57.63% NA
All Japonica  1512 70.30% 0.10% 8.60% 21.03% NA
Aus  269 37.50% 1.10% 8.18% 53.16% NA
Indica I  595 4.40% 3.40% 44.71% 47.56% NA
Indica II  465 8.80% 5.20% 15.05% 70.97% NA
Indica III  913 7.70% 17.10% 14.90% 60.35% NA
Indica Intermediate  786 12.30% 8.80% 24.68% 54.20% NA
Temperate Japonica  767 96.00% 0.00% 0.39% 3.65% NA
Tropical Japonica  504 41.90% 0.20% 23.61% 34.33% NA
Japonica Intermediate  241 48.10% 0.00% 3.32% 48.55% NA
VI/Aromatic  96 26.00% 1.00% 51.04% 21.88% NA
Intermediate  90 42.20% 2.20% 20.00% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0813652482 C -> T LOC_Os08g22690.1 upstream_gene_variant ; 3267.0bp to feature; MODIFIER silent_mutation Average:16.285; most accessible tissue: Callus, score: 50.261 N N N N
vg0813652482 C -> T LOC_Os08g22700.1 upstream_gene_variant ; 465.0bp to feature; MODIFIER silent_mutation Average:16.285; most accessible tissue: Callus, score: 50.261 N N N N
vg0813652482 C -> T LOC_Os08g22710.1 upstream_gene_variant ; 2440.0bp to feature; MODIFIER silent_mutation Average:16.285; most accessible tissue: Callus, score: 50.261 N N N N
vg0813652482 C -> T LOC_Os08g22690-LOC_Os08g22700 intergenic_region ; MODIFIER silent_mutation Average:16.285; most accessible tissue: Callus, score: 50.261 N N N N
vg0813652482 C -> DEL N N silent_mutation Average:16.285; most accessible tissue: Callus, score: 50.261 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0813652482 NA 7.06E-14 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 1.06E-06 3.53E-15 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 NA 1.65E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 NA 6.26E-14 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 NA 3.42E-07 mr1182 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 NA 1.30E-13 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 NA 1.38E-08 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 NA 2.27E-07 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 NA 2.80E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 1.88E-06 5.53E-17 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 7.86E-06 4.01E-15 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 NA 1.82E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 NA 5.20E-14 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 NA 2.74E-07 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 NA 2.82E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 NA 2.00E-07 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 2.97E-06 2.44E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 NA 1.59E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 NA 1.14E-08 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 NA 1.71E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 NA 2.94E-06 mr1733_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 4.61E-06 3.77E-06 mr1825_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 NA 1.22E-06 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 NA 6.34E-09 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652482 NA 4.69E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251