\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813652329:

Variant ID: vg0813652329 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 13652329
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTTACTAAGGTTGTCAAAAGCATGGGCATCAATTCAACAATATGGCTATATAACAAGGAACATTGGAATATTAACTATTAAATAAACAATGGTGAGCG[C/T]
CATATAATTTATAAAAGCGATGCATATAGAAGTGAAACAACATAGTTTTTGCAATAATGGGGTTCAATATGTTCAAGGAATATGGTATGACTTGCCTTGC

Reverse complement sequence

GCAAGGCAAGTCATACCATATTCCTTGAACATATTGAACCCCATTATTGCAAAAACTATGTTGTTTCACTTCTATATGCATCGCTTTTATAAATTATATG[G/A]
CGCTCACCATTGTTTATTTAATAGTTAATATTCCAATGTTCCTTGTTATATAGCCATATTGTTGAATTGATGCCCATGCTTTTGACAACCTTAGTAAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.90% 13.80% 5.18% 44.05% NA
All Indica  2759 18.50% 21.20% 4.13% 56.14% NA
All Japonica  1512 70.80% 2.40% 4.03% 22.75% NA
Aus  269 40.90% 2.60% 7.06% 49.44% NA
Indica I  595 5.20% 43.20% 5.04% 46.55% NA
Indica II  465 15.30% 12.50% 3.01% 69.25% NA
Indica III  913 25.00% 12.50% 3.94% 58.60% NA
Indica Intermediate  786 23.00% 19.80% 4.33% 52.80% NA
Temperate Japonica  767 96.60% 0.50% 0.00% 2.87% NA
Tropical Japonica  504 42.90% 6.00% 9.92% 41.27% NA
Japonica Intermediate  241 47.30% 0.80% 4.56% 47.30% NA
VI/Aromatic  96 11.50% 17.70% 44.79% 26.04% NA
Intermediate  90 46.70% 10.00% 8.89% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0813652329 C -> T LOC_Os08g22690.1 upstream_gene_variant ; 3114.0bp to feature; MODIFIER silent_mutation Average:18.227; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0813652329 C -> T LOC_Os08g22700.1 upstream_gene_variant ; 618.0bp to feature; MODIFIER silent_mutation Average:18.227; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0813652329 C -> T LOC_Os08g22710.1 upstream_gene_variant ; 2593.0bp to feature; MODIFIER silent_mutation Average:18.227; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0813652329 C -> T LOC_Os08g22690-LOC_Os08g22700 intergenic_region ; MODIFIER silent_mutation Average:18.227; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0813652329 C -> DEL N N silent_mutation Average:18.227; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0813652329 NA 2.57E-15 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 3.06E-06 4.67E-17 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 3.82E-15 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 1.72E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 6.75E-07 6.38E-20 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 7.65E-11 mr1496 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 7.53E-07 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 1.16E-19 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 2.87E-07 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 4.84E-16 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 4.17E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 2.93E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 4.28E-06 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 4.80E-18 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 3.48E-10 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 8.18E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 8.83E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 3.61E-07 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 3.07E-06 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 2.94E-06 5.56E-07 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 4.48E-08 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 3.11E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 7.43E-06 NA mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 1.25E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 1.23E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 4.69E-07 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652329 NA 1.18E-09 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251