\
| Variant ID: vg0813652329 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 13652329 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 103. )
ATTTTACTAAGGTTGTCAAAAGCATGGGCATCAATTCAACAATATGGCTATATAACAAGGAACATTGGAATATTAACTATTAAATAAACAATGGTGAGCG[C/T]
CATATAATTTATAAAAGCGATGCATATAGAAGTGAAACAACATAGTTTTTGCAATAATGGGGTTCAATATGTTCAAGGAATATGGTATGACTTGCCTTGC
GCAAGGCAAGTCATACCATATTCCTTGAACATATTGAACCCCATTATTGCAAAAACTATGTTGTTTCACTTCTATATGCATCGCTTTTATAAATTATATG[G/A]
CGCTCACCATTGTTTATTTAATAGTTAATATTCCAATGTTCCTTGTTATATAGCCATATTGTTGAATTGATGCCCATGCTTTTGACAACCTTAGTAAAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.90% | 13.80% | 5.18% | 44.05% | NA |
| All Indica | 2759 | 18.50% | 21.20% | 4.13% | 56.14% | NA |
| All Japonica | 1512 | 70.80% | 2.40% | 4.03% | 22.75% | NA |
| Aus | 269 | 40.90% | 2.60% | 7.06% | 49.44% | NA |
| Indica I | 595 | 5.20% | 43.20% | 5.04% | 46.55% | NA |
| Indica II | 465 | 15.30% | 12.50% | 3.01% | 69.25% | NA |
| Indica III | 913 | 25.00% | 12.50% | 3.94% | 58.60% | NA |
| Indica Intermediate | 786 | 23.00% | 19.80% | 4.33% | 52.80% | NA |
| Temperate Japonica | 767 | 96.60% | 0.50% | 0.00% | 2.87% | NA |
| Tropical Japonica | 504 | 42.90% | 6.00% | 9.92% | 41.27% | NA |
| Japonica Intermediate | 241 | 47.30% | 0.80% | 4.56% | 47.30% | NA |
| VI/Aromatic | 96 | 11.50% | 17.70% | 44.79% | 26.04% | NA |
| Intermediate | 90 | 46.70% | 10.00% | 8.89% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0813652329 | C -> T | LOC_Os08g22690.1 | upstream_gene_variant ; 3114.0bp to feature; MODIFIER | silent_mutation | Average:18.227; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0813652329 | C -> T | LOC_Os08g22700.1 | upstream_gene_variant ; 618.0bp to feature; MODIFIER | silent_mutation | Average:18.227; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0813652329 | C -> T | LOC_Os08g22710.1 | upstream_gene_variant ; 2593.0bp to feature; MODIFIER | silent_mutation | Average:18.227; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0813652329 | C -> T | LOC_Os08g22690-LOC_Os08g22700 | intergenic_region ; MODIFIER | silent_mutation | Average:18.227; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0813652329 | C -> DEL | N | N | silent_mutation | Average:18.227; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0813652329 | NA | 2.57E-15 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | 3.06E-06 | 4.67E-17 | mr1118 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 3.82E-15 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 1.72E-06 | mr1242 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | 6.75E-07 | 6.38E-20 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 7.65E-11 | mr1496 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 7.53E-07 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 1.16E-19 | mr1118_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 2.87E-07 | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 4.84E-16 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 4.17E-07 | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 2.93E-07 | mr1401_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 4.28E-06 | mr1415_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 4.80E-18 | mr1495_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 3.48E-10 | mr1496_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 8.18E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 8.83E-07 | mr1531_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 3.61E-07 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 3.07E-06 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | 2.94E-06 | 5.56E-07 | mr1580_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 4.48E-08 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 3.11E-07 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | 7.43E-06 | NA | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 1.25E-06 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 1.23E-06 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 4.69E-07 | mr1904_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652329 | NA | 1.18E-09 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |