Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813652248:

Variant ID: vg0813652248 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 13652248
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTTGGATCTACGCATAGATAAGCCCAACCTAAAGCAACTAGTAAGTCCATCATATAGGGAACCATACTAGTCATTTTATCATTTTACTAAGGTTGTCAA[A/G]
AGCATGGGCATCAATTCAACAATATGGCTATATAACAAGGAACATTGGAATATTAACTATTAAATAAACAATGGTGAGCGCCATATAATTTATAAAAGCG

Reverse complement sequence

CGCTTTTATAAATTATATGGCGCTCACCATTGTTTATTTAATAGTTAATATTCCAATGTTCCTTGTTATATAGCCATATTGTTGAATTGATGCCCATGCT[T/C]
TTGACAACCTTAGTAAAATGATAAAATGACTAGTATGGTTCCCTATATGATGGACTTACTAGTTGCTTTAGGTTGGGCTTATCTATGCGTAGATCCAACA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.30%	3.00%	16.93%	43.80%	NA
All Indica	2759	18.00%	4.60%	23.31%	54.08%	NA
All Japonica	1512	70.40%	0.50%	4.83%	24.27%	NA
Aus	269	39.00%	1.50%	5.20%	54.28%	NA
Indica I	595	6.20%	2.20%	42.18%	49.41%	NA
Indica II	465	14.40%	1.50%	13.76%	70.32%	NA
Indica III	913	23.90%	9.90%	15.77%	50.49%	NA
Indica Intermediate	786	22.10%	2.30%	23.41%	52.16%	NA
Temperate Japonica	767	96.10%	0.00%	0.26%	3.65%	NA
Tropical Japonica	504	42.10%	1.60%	13.49%	42.86%	NA
Japonica Intermediate	241	47.70%	0.00%	1.24%	51.04%	NA
VI/Aromatic	96	11.50%	1.00%	59.38%	28.12%	NA
Intermediate	90	43.30%	0.00%	14.44%	42.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0813652248	A -> G	LOC_Os08g22690.1	upstream_gene_variant ; 3033.0bp to feature; MODIFIER	silent_mutation	Average:20.263; most accessible tissue: Callus, score: 36.574	N	N	N	N
vg0813652248	A -> G	LOC_Os08g22700.1	upstream_gene_variant ; 699.0bp to feature; MODIFIER	silent_mutation	Average:20.263; most accessible tissue: Callus, score: 36.574	N	N	N	N
vg0813652248	A -> G	LOC_Os08g22710.1	upstream_gene_variant ; 2674.0bp to feature; MODIFIER	silent_mutation	Average:20.263; most accessible tissue: Callus, score: 36.574	N	N	N	N
vg0813652248	A -> G	LOC_Os08g22690-LOC_Os08g22700	intergenic_region ; MODIFIER	silent_mutation	Average:20.263; most accessible tissue: Callus, score: 36.574	N	N	N	N
vg0813652248	A -> DEL	N	N	silent_mutation	Average:20.263; most accessible tissue: Callus, score: 36.574	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0813652248	NA	5.47E-15	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	1.69E-06	3.29E-18	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	NA	1.06E-14	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	NA	2.25E-06	mr1242	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	6.30E-08	2.27E-21	mr1495	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	NA	4.01E-10	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	NA	7.49E-08	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	NA	2.26E-06	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	NA	5.73E-21	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	NA	7.40E-07	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	NA	4.97E-16	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	NA	1.60E-06	mr1242_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	NA	7.15E-06	mr1377_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	NA	2.15E-06	mr1415_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	NA	1.88E-19	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	NA	3.23E-09	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	NA	1.18E-06	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	NA	8.51E-07	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	NA	4.44E-06	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	NA	3.05E-06	mr1580_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	NA	2.00E-07	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	NA	1.02E-06	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	7.53E-06	NA	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	NA	4.41E-06	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652248	NA	3.15E-09	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251