\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813652209:

Variant ID: vg0813652209 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 13652209
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAGTTGTTACCACAGTCTAATTTATAAAAAGGATTCTATGTTGGATCTACGCATAGATAAGCCCAACCTAAAGCAACTAGTAAGTCCATCATATAGGGA[A/G]
CCATACTAGTCATTTTATCATTTTACTAAGGTTGTCAAAAGCATGGGCATCAATTCAACAATATGGCTATATAACAAGGAACATTGGAATATTAACTATT

Reverse complement sequence

AATAGTTAATATTCCAATGTTCCTTGTTATATAGCCATATTGTTGAATTGATGCCCATGCTTTTGACAACCTTAGTAAAATGATAAAATGACTAGTATGG[T/C]
TCCCTATATGATGGACTTACTAGTTGCTTTAGGTTGGGCTTATCTATGCGTAGATCCAACATAGAATCCTTTTTATAAATTAGACTGTGGTAACAACTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.40% 4.70% 13.03% 27.89% NA
All Indica  2759 44.30% 6.40% 15.88% 33.45% NA
All Japonica  1512 71.70% 2.40% 4.23% 21.63% NA
Aus  269 46.80% 2.60% 35.69% 14.87% NA
Indica I  595 38.50% 5.50% 23.70% 32.27% NA
Indica II  465 28.20% 7.10% 12.47% 52.26% NA
Indica III  913 55.90% 6.40% 11.83% 25.96% NA
Indica Intermediate  786 44.70% 6.70% 16.67% 31.93% NA
Temperate Japonica  767 96.20% 0.00% 0.39% 3.39% NA
Tropical Japonica  504 46.00% 7.10% 11.11% 35.71% NA
Japonica Intermediate  241 47.30% 0.40% 2.07% 50.21% NA
VI/Aromatic  96 85.40% 0.00% 8.33% 6.25% NA
Intermediate  90 62.20% 2.20% 11.11% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0813652209 A -> G LOC_Os08g22690.1 upstream_gene_variant ; 2994.0bp to feature; MODIFIER silent_mutation Average:20.205; most accessible tissue: Callus, score: 36.574 N N N N
vg0813652209 A -> G LOC_Os08g22700.1 upstream_gene_variant ; 738.0bp to feature; MODIFIER silent_mutation Average:20.205; most accessible tissue: Callus, score: 36.574 N N N N
vg0813652209 A -> G LOC_Os08g22710.1 upstream_gene_variant ; 2713.0bp to feature; MODIFIER silent_mutation Average:20.205; most accessible tissue: Callus, score: 36.574 N N N N
vg0813652209 A -> G LOC_Os08g22690-LOC_Os08g22700 intergenic_region ; MODIFIER silent_mutation Average:20.205; most accessible tissue: Callus, score: 36.574 N N N N
vg0813652209 A -> DEL N N silent_mutation Average:20.205; most accessible tissue: Callus, score: 36.574 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0813652209 NA 3.54E-15 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 1.50E-07 5.28E-20 mr1118 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 NA 3.46E-15 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 NA 6.90E-06 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 1.35E-07 1.08E-21 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 NA 2.00E-10 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 NA 1.06E-07 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 NA 2.26E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 9.64E-08 7.64E-26 mr1118_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 NA 3.81E-07 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 NA 1.29E-17 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 NA 4.45E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 NA 2.16E-06 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 NA 2.15E-06 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 3.40E-06 1.33E-22 mr1495_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 NA 4.66E-11 mr1496_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 NA 1.59E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 NA 8.51E-07 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 NA 4.44E-06 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 2.27E-06 2.28E-07 mr1580_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 NA 2.00E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 NA 2.90E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 7.53E-06 NA mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 6.19E-06 4.18E-07 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 NA 5.01E-06 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 NA 7.24E-06 mr1849_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 NA 1.18E-08 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813652209 NA 4.66E-10 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251