| Variant ID: vg0813652209 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 13652209 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTAGTTGTTACCACAGTCTAATTTATAAAAAGGATTCTATGTTGGATCTACGCATAGATAAGCCCAACCTAAAGCAACTAGTAAGTCCATCATATAGGGA[A/G]
CCATACTAGTCATTTTATCATTTTACTAAGGTTGTCAAAAGCATGGGCATCAATTCAACAATATGGCTATATAACAAGGAACATTGGAATATTAACTATT
AATAGTTAATATTCCAATGTTCCTTGTTATATAGCCATATTGTTGAATTGATGCCCATGCTTTTGACAACCTTAGTAAAATGATAAAATGACTAGTATGG[T/C]
TCCCTATATGATGGACTTACTAGTTGCTTTAGGTTGGGCTTATCTATGCGTAGATCCAACATAGAATCCTTTTTATAAATTAGACTGTGGTAACAACTAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.40% | 4.70% | 13.03% | 27.89% | NA |
| All Indica | 2759 | 44.30% | 6.40% | 15.88% | 33.45% | NA |
| All Japonica | 1512 | 71.70% | 2.40% | 4.23% | 21.63% | NA |
| Aus | 269 | 46.80% | 2.60% | 35.69% | 14.87% | NA |
| Indica I | 595 | 38.50% | 5.50% | 23.70% | 32.27% | NA |
| Indica II | 465 | 28.20% | 7.10% | 12.47% | 52.26% | NA |
| Indica III | 913 | 55.90% | 6.40% | 11.83% | 25.96% | NA |
| Indica Intermediate | 786 | 44.70% | 6.70% | 16.67% | 31.93% | NA |
| Temperate Japonica | 767 | 96.20% | 0.00% | 0.39% | 3.39% | NA |
| Tropical Japonica | 504 | 46.00% | 7.10% | 11.11% | 35.71% | NA |
| Japonica Intermediate | 241 | 47.30% | 0.40% | 2.07% | 50.21% | NA |
| VI/Aromatic | 96 | 85.40% | 0.00% | 8.33% | 6.25% | NA |
| Intermediate | 90 | 62.20% | 2.20% | 11.11% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0813652209 | A -> G | LOC_Os08g22690.1 | upstream_gene_variant ; 2994.0bp to feature; MODIFIER | silent_mutation | Average:20.205; most accessible tissue: Callus, score: 36.574 | N | N | N | N |
| vg0813652209 | A -> G | LOC_Os08g22700.1 | upstream_gene_variant ; 738.0bp to feature; MODIFIER | silent_mutation | Average:20.205; most accessible tissue: Callus, score: 36.574 | N | N | N | N |
| vg0813652209 | A -> G | LOC_Os08g22710.1 | upstream_gene_variant ; 2713.0bp to feature; MODIFIER | silent_mutation | Average:20.205; most accessible tissue: Callus, score: 36.574 | N | N | N | N |
| vg0813652209 | A -> G | LOC_Os08g22690-LOC_Os08g22700 | intergenic_region ; MODIFIER | silent_mutation | Average:20.205; most accessible tissue: Callus, score: 36.574 | N | N | N | N |
| vg0813652209 | A -> DEL | N | N | silent_mutation | Average:20.205; most accessible tissue: Callus, score: 36.574 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0813652209 | NA | 3.54E-15 | mr1026 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652209 | 1.50E-07 | 5.28E-20 | mr1118 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652209 | NA | 3.46E-15 | mr1161 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652209 | NA | 6.90E-06 | mr1242 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652209 | 1.35E-07 | 1.08E-21 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652209 | NA | 2.00E-10 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652209 | NA | 1.06E-07 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652209 | NA | 2.26E-06 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652209 | 9.64E-08 | 7.64E-26 | mr1118_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0813652209 | NA | 3.81E-07 | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/